Авторазбор

Разборка грузовиков Мерседес–Бенц (Mercedes-Benz)

Содержание

Обозначение значков на панели приборов ВАЗ 2114: кнопки, индикаторы, лампочки, схема

Приборная панель ВАЗ 2114 – главный информационный блок, на которой отображаются данные о текущем функциональном состоянии автомобиля. Расположена она на торпеде, прямо перед сидением водителя.

Приборка ВАЗ 2114, 2113,2115

На самой панели находится  элементы трех видов:

  • Лампочки-индикаторы, свидетельствующие о количестве необходимых для работы автомобиля расходных элементов – бензина, масла, тормозной жидкости и тд;
  • Спидометр и тахометр;
  • Управляющий элемент для переключения режима работы спидометра.

Также к понятию «комбинация приборов» принято относить рычаги включения поворотников, кнопки для управления фарами, печкой, и другими коммуникациями машины.

Схема приборной панели ВАЗ 2114 выглядит следующим образом:

Панель приборов (схема)

Из данной статьи вы узнаете обозначение значков на приборной панели ВАЗ 2114, причины загорания индикаторов, а также меры, которые необходимо принять для устранения возникших неполадок.

ОСНОВНЫЕ ЭЛЕМЕНТЫ ПАНЕЛИ

Основное место на приборной панели отведено для тахометра и спидометра, датчика количества топлива и текущей температуры жидкости в системе охлаждения. Разберем основные обозначения на панели ВАЗ 2114 детальнее.

Тахометр ВАЗ 2114 – это стрелочное устройство, сигнал на которое подает бортовой компьютер четырнадцатой. На тахометр выводятся данные о количестве оборотов коленного вала в текущий момент времени. Тахометр разделен шкалами на 5 единиц, оцифровывается из которых каждая вторая. Максимальное числовое значение оборотов – 80.

Чтобы узнать реальные обороты двигателя при движении автомобиля показатель тахометра необходимо умножать на 100. К примеру, если стрелка расположена на отметке 40, значит коленвал выполняет 4000 оборотов в минуту.

Производителем указана критическая величина оборотов, при достижении которой двигатель четырнадцатой может выйти из строя из-за чрезмерной нагрузки. На приборе она выделена красной штриховкой, эта величина составляет от 6000 до 8000 оборотов.

Под тахометром расположено электронное окошко, на которое выводятся данные о текущем времени и температуре воздуха окружающей среды.

Четырнадцатая обладает индукционным стрелочным спидометром, который расположен в правой части приборной панели. Спидометр также поделен на секторы, величина деления – 10 километров. Максимальная отметка – 200 км.

Спидометр работает от датчика измерения скорости, расположенного внутри коробки переключения передач. Стоит учитывать, что все индукционные спидометры, в том числе и тот, что установлен на четырнадцатой, обладают допустимым уровнем погрешности в 5 км/час.

Снизу стрелки спидометра находится электронный экранчик, на котором можно увидеть данные об общем пробеге автомобиля и пробеге с последней точки отсчета. Точку отсчета может устанавливать сам водитель, для этого под цифрой 200 на спидометре расположен ручной переключатель, сбивающий текущий отсчет пробега к нулю.

  • Датчик количества бензина

Справа на панели приборов ВАЗ 2114 (приборная панель ВАЗ 2114 и обозначение индикаторов на панели приборов ВАЗ 2113 полностью аналогичны четырнацатой модели) расположен стрелочный датчик текущего количества топлива в бензобаке.

Шкала датчика разделена на три отметки: 1 – полный бак, ½ – бак заполнен на половину, 0 – пустой бак.

Рядом с датчиком расположен цветовой индикатор – лампочка, которая загорается оранжевым цветом тогда, когда уровень топлива близок к критическому минимуму. При загорании лампочки необходимо в течение 20-30 километров дозаправить автомобиль.

Датчик температуры охлаждающей жидкости разделен градациями на 20 единиц. Минимальная температура – 50, максимальная – 130 градусов. Критическая зона температуры начинается с 105 градусов, она отмечена красной штриховкой.

Если охлаждающая жидкость четырнадцатой закипает, то необходимо тут же остановить автомобиль и заглушить двигатель, поскольку езда в таком режиме чревата серьезными неприятностями, вплоть до полной поломки мотора.

Если не работает датчик температуры на приборной панели ВАЗ 2114, необходимо проверить проводку, посредством которой датчик подведен к емкости с охлаждающей жидкостью. Также возможно окисления контактов датчика, их необходим либо протереть растворителем, либо заменить датчик на новый.

ИНДИКАТОРНЫЕ ЛАПОЧКИ

Также панель приборов на ВАЗ 2114 имеет блок световых индикаторов, который включает следующие значки:

Индикаторы

Разберем обозначение значков на панели приборов детальнее:

  1. Индикатор, выводящий информацию о текущем уровне масла в двигателе. При критически низком количестве смазывающей жидкости лампочка загорается оранжевым цветом. Масло необходимо долить сразу же после того, как этот индикатор станет активным;
  2. Данный индикатор свидетельствует о низком количестве рабочей жидкости в емкости стеклоомывателя. Бачек рассчитан на 5 литров жидкости, индикатор включается, когда её количество падает ниже 1 литра;
  3. Датчик количества жидкости в системе охлаждения двигателя. Один из важнейших индикаторов, за которым необходимо тщательно следить;
  4. Указывает на наличие незакрытых дверей. Горит красным цветом;
  5. Индикатор, который загорается, если габариты, либо стоп-сигнальные лампы вышли из строя. Цвет активного индикатора – красный;
  6. Лампочка, которая загорается в случае критического износа тормозных колодок (1.5 мм). Горит с момента первого нажатия тормозов до выключения автомобиля;
  7. Индикатор, свидетельствующий о том, что водитель не пристегнут ремнями безопасности.

Восклицательный знак на панели приборов ВАЗ 2114 может гореть в двух случаях: при включенной стартере автомобиля, и при низком уровне тормозной жидкости. Как правило, причина во втором варианте.

Для устранения проблемы полностью заполните бачек и проверьте контакты датчика уровня ТЗ, которые расположены на крышке емкости, на предмет окисления.

Если горит значок двигателя на панельке, значит с силовым агрегатом четырнадцатой что-то не в порядке. Причин у загорания лампочки «Check Engine» очень много, нередко она горит даже тогда, когда каких-либо видимых неисправностей нет. Лучше всего съездить в СТО на диагностику, так вы обезопасите от возможных проблем.

КНОПКИ НА ПРИБОРНОЙ ПАНЕЛИ

В центре приборной панели располагается ряд из пяти кнопок:

Кнопки

Описание кнопок панели приборов ВАЗ 2114 следующее:

Первый блок:

  1. Включение/отключение габаритных огней. При включенных габаритах лампочка горит зеленым цветом;
  2. Кнопка включения и выключения фар;

Второй блок:

  1. Включение/отключение передних противотуманок. Для того чтобы включить противотуманные фары предварительно необходимо включить габаритные огни;
  2. Включение/отключение задних противотуманок;
  3. Включение/отключение обогрева стекла на двери багажника четырнадцатой.

Панель приборов ВАЗ 2114, 2115: кнопки, индикаторы, лампочки

Не удивительно, что абсолютно каждое современное авто оборудовано приборной панелью, ведь именно благодаря ей водитель может следить за основными узнали автомобиля. И панель приборов ВАЗ 2114, 2115 не исключение. Проще говоря такая панель играет роль связующего звена между человеком и транспортным средством.

По мере развития приборная панель оснащалась дополнительными датчиками и индикаторами, которые делают процесс управления авто более удобным и безопасным. Если вы хотите знать какие элементы находятся на приборной панели ВАЗ 2114, 2115 тогда обязательно ознакомьтесь с данной статьей.

 

  1. Обозначения лампочек, индикаторов,  значков и кнопок на панели приборов ВАЗ 2114, 2115
  2. Обозначения контрольных ламп и индикаторов панели приборов ВАЗ 2114, 2115. Видео
  3. Замена лампочек панели приборов ВАЗ 2114, 2115. Видео
  4. Подсветка панели приборов ВАЗ 2114, 2115. Диагностика, ремонт.
  5. Как правильно сделать самодиагностику панели приборов ВАЗ 2110, 2111, 2112, 2114, 2115.

Обозначения лампочек, индикаторов,  значков и кнопок на панели приборов ВАЗ 2114, 2115

Сначала рассмотрим описания и значение значков и кнопок панели, в независимости от того оснащена машина инжектором или карбюратором.

Схема панели приборов ВАЗ 2114, 2115

 

1 — Датчик контроля, измеряющий температуру охлаждающей жидкости в системе охлаждения двигателя. При нормальной работе силового агрегата температура антифриза не должна превышать показатель в 90 градусов. Но минимальные отклонения иногда допустимы. Если вы заметили, что двигатель стал часто перегреваться, обязательно обратитесь за помощью в автосервис. Иногда сам датчик может показывать неверные результаты.

2 — Такое устройство, как тахометр обрабатывает информацию, которая поступает от коленвала и выводит её на панель. Показатели тахометра указывают на количество оборотов двигателя.

3,4 — Индикаторы поворотов. В случае, когда индикаторы мигают одновременно, но медленно, это может свидетельствовать о возможной проблеме с самими лампочками или в сети электропроводки.

5 — Самым основным элементом любой панели приборов считается – спидометр. Благодаря ему водитель может определить скорость движения. Незначительная погрешность в показателях допускается, но она не должна превышать показатель более чем на 5 километров. Если подобные показания существенно отличаются от реальных, то вероятнее всего проблема именно в спидометре.

6 — Датчик уровня топлива в топливном баке. Когда в баке уровень снижается до 6-7 литров загорается красная лампочка, что свидетельствует о том, что необходимо дозаправить автомобиль.

7 — Индикатор низкого уровня топлива.

8 — Символ обозначающий включение света. Срабатывает он в случае включения ближнего света и габаритов.

9 —  Лампочка тормозов свидетельствует о том, что система тормозов автомобиля работает некорректно. Чаще всего она загорается если в автомобиле не хватает тормозной жидкости.

10 — Лампочка синего цвета обозначает включенный дальний свет фар.

11 — Кнопка для сброса суточного показателя пробега. Сверху показан общий пробег автомобиля, а снизу суточный.

12 — дисплей бортового компьютера с показателями пробега.

13 — Символ включения сигнализации (световой). При включении аварийного света лампочка начинает мигать красным цветом.

14 — Символ «Чек». Он срабатывает в случае возможных проблем с силовым агрегатом автомобиля. Причин этому может быть множество, от проблем со смешиванием горючей смеси с воздухом, до поломки различных силовых узлов двигателя. В любом случае необходимо обратиться в сервис для компьютерной диагностики или ремонта.

15 — Датчик внешней температуры воздуха и показатели времени. Кнопка сброса суточного пробега позволяет при её прокручивании переходить от показателей температуры до показателей времени.

16 — Датчик заряда аккумулятора. Чаще всего он загорается в случае практически полного разряда АКБ. Если свет индикатора очень слабый или наоборот яркий, то проблема может быть в генераторе.

17 — Значок активации ручного тормоза. Горит он как при включенном двигателе, так и наоборот.

18 — Значок показывающий давление моторной жидкости. Обычно его появление сигнализирует о недостаточном количестве смазывающей смеси. В подобном случае обязательно проверьте уровень масла. Иногда проблема может быть при неправильной работы масляного насоса.

19 — Если двигатель оснащен инжектором, то на приборной панели находится резервный значок. Ну а если двигатель карбюраторный, то это индикатор подсоса.

Кнопки на панели приборов

  1. Включатель габаритов
  2. Ближний свет фар
  3. Кнопка передних противотуманок
  4. Задние противотуманки
  5. Обогрев заднего стекла

Обозначения контрольных ламп и индикаторов панели приборов ВАЗ 2114, 2115. Видео

 

Замена лампочек панели приборов ВАЗ 2114, 2115. Видео

 

Подсветка панели приборов ВАЗ 2114, 2115. Диагностика, ремонт.

Панель приборов является достаточно сложным узлом, и соответственно он может выйти из строя, как и любой другой узел автомобиля. Панель часто не работает или перестает гореть.

Какие основные проблемы могут наблюдаться при неисправной приборной панели ВАЗ 2114, 2115:

1. Основная подсветка ПП исчезла, но остальные датчики продолжают работать или наоборот. Чаще всего такая проблема возникает в случае выхода из строя предохранителей панели. Они имеют маркировку F16. Такой предохранитель помимо подсветки панели отвечает еще и за поворотники, а также световую сигнализацию (аварийку), и фонари заднего хода. Если аварийка и поворотники работают нормально, то скорее всего проблема в электроцепи, возможно произошло замыкание.

Ниже на видео показано как починить подсветку приборной панели:

2. Спидометр и тахометр неправильно работают. В таком случае сначала советуется проверять датчики положения коленвала, а также датчики скорости. Если эти датчики работают правильно, то возможно проблема заключается в плохом контакте электросети или в повреждении непосредственно самой проводки.

3. Если не работают некоторые датчики, но остальные элементы работают правильно, то возможно вышли из строя лампочки. В таком случае необходимо просто заменить их на новые.

4. Если стрелка показывающая уровень топлива в баке или уровень охлаждающей жидкости упала в самый низ, или наоборот всегда находится в верхнем положении, то скорее всего проблема в датчиках или электроцепи. Спешить с заменой датчиков не стоит. Сначала проверьте проводку, правильно ли она работает и нет ли замыкания. В таком случае лучше всего обратиться к профессионалам.

5. Часто случается, что в общем приборная панель работает нормально, но время от времени наблюдаются перебои в работе некоторых датчиков. Зачастую причина находится в электроцепи. Также причина может быть в некорректной работе процессора.

Как правильно сделать самодиагностику панели приборов ВАЗ 2110, 2111, 2112, 2114, 2115.

Не стоит забывать о том, что ПП обеспечивает обратную связь водителя с автомобилем, поэтому она должна правильно справляться со своими основными функциями. В противном случае, это может привести к аварийной ситуации во время движения. Если вы заметили различные проблемы в работе панели, то не стоит откладывать, как можно быстрее решите эту проблему.

Обозначение значков на панели приборов ВАЗ 2114: кнопки, индикаторы, схема

Панель приборов автомобиля ВАЗ 2114 является главным информационным блоком автомобиля. Благодаря ему водитель получает информацию о техническом состоянии и работе всех узлов, приборов и датчиков машины, которые отображены в схемах. В статье рассматриваются основные элементы панели, дается расшифровка значков и кнопок приборной панели, а также схема их расположения.

Содержание

[ Раскрыть]

[ Скрыть]

Составляющие панели

Электронная приборная панель расположена на торпеде авто так, что водитель может видеть все значки и лампочки индикаторов. Благодаря тюнингу авто с инжектором пользоваться автоприборами (АП) стало удобнее. Для того, чтобы эффективно использовать информацию с приборной панели, каждый водитель должен знать ее состав, комбинацию, назначение и схему расположения всех кнопок и индикаторов.

Приборная панель автомобиля ВАЗ 2114

Основными элементами, которые расположены с левой стороны панели, являются:

  1. Спидометр. На ВАЗ 2114 установлен индукционный спидометр, который выдает на табло показания текущей скорости, получаемые от датчика, расположенного в коробке передач. Шкала прибора разбита на деления ценой 10 км/ч и показывает скорость от 0 до 200 км/ч. Для спидометра допускается погрешность 5 км/ч. Под циферблатом по центру расположены две электронные надписи, в которых отражается информация о пробеге автомобиля: общем и текущем.
  2. Тахометр. Рядом со спидометром слева находится тахометр. Он передает показания количества оборотов коленчатого вала в реальном времени. Эти данные он получает от бортового компьютера. Цифры указаны через каждые 10 единиц шкалы. Одно деление равняется 5 единицам. Максимально возможное значение 80 единиц. Для получения числа оборотов коленвала нужно значение на тахометре умножить на 100. Например, 45 единиц означает, что коленвал совершает 4500 оборотов в минуту. Диапазон от 55 до 60 заштрихован красным цветом, предупреждая, что двигатель работает в сложных условиях и может в любой момент сломаться. Под тахометром в средней части электроника показывает температуру окружающего воздуха и время.
  3. Указатель температуры охлаждающей жидкости (ОЖ). С левой стороны от тахометра высвечивается показание датчика температуры ОЖ, расположенный около термостата и ГБЦ. Оцифровка начинается от 50, цена деления 20 градусов, следующая цифра 90 и максимальное значение – 130 градусов. Если значение находится в диапазоне от 105 до 130 градусов, то нужно прекратить движение, выключить мотор и дать ему остыть, иначе двигатель может закипеть.
  4. Указатель уровня топлива в бензобаке. Находится с правой стороны от спидометра. Каждая из цифр имеет свое обозначение: 0- бак пуст; 1/2- бак наполнен наполовину; 1-полный бак (автор видео IZO)))LENTA).

В верхней части расположен электронный значок бензоколонки, он означает, что бак заполнен полностью. В правом нижнем углу такой же электронный значок горит оранжевым цветом в случае, если в баке осталось меньше 6 литров бензина.

Устройство панели приборов не сложное. Если хочется, чтобы автомобиль отличался от других, многие используют для этого тюнинг. С его помощью можно сделать салон уютным и эффектным. Чаще всего тюнингу подвергают панель приборов, делают более яркой подсветку, выполняют вставки накладок, деталей.

Тюнинг приборки ВАЗ 2114

Для того, чтобы сделать тюнинг подсветки и других частей панели, нужно проделать несложные действия:

  • разобрать панель;
  • снять щиток;
  • сделать тюнинг задуманных частей, подсветки, вставки дополнительных лампочек и деталей;
  • вернуть снятые детали на место.

Тюнинг подсветки заключается в замене желтых индикаторов на яркие светодиоды.

Индикаторные лапочки

Обозначения на приборной панели ВАЗ 2114 сделаны согласно требованиям и нормам. Они унифицированы для того, чтобы были понятны всем водителям. Обозначения индикаторов расположены в нижней части щитка.

Тюнинг панели приборов ВАЗ 2114

В таблице дается описание обозначений, которые используются в схемах и на приборной панели.

ИзображениеОбозначение
Канистра с каплейСигнализирует, что уровень масла в катере ДВС опустился ниже минимально допустимого, горит значок красным цветом.
Дворники и фонтанчикСообщает о том, если остаток омывающей жидкости в бачке составляет меньше одного литра. Индикатор начинает светиться оранжевым цветом.
ТермометрСветится оранжевым цветом, если в расширительном бачке недостаточный уровень охлаждающей жидкости.
Авто с открытыми дверьмиГорит красным цветом, если не закрыта одна из дверей.
Значок перечеркнутой лампочкиОзначает, что есть проблемы со стоп-сигналами или габаритами.
Круг с черточками по бокамСигнализирует об износе колодок тормозной системы и неисправностях тормозов.
Человечек с ремнями безопасностиСообщает, что водитель или один из пассажиров не использует ремни безопасности.
Две зеленые стрелки вверху щиткаЗагораются соответствующие лампочки при включении правого или левого поворотника.
Красный треугольникЗагорается при аварийной остановке.
Check EngineСигнализирует о неполадках с двигателем. Горит красным цветом.
Синяя лампочкаГорит при включении дальнего света
Зеленая лампочкаГорит при включении света ближнего
Обозначения, относящиеся к более ранним версия ВАЗ 2114
Канистра с каплей жидкости красного цветаЗагорается, если давление масла не отвечает требованиям, то есть падает ниже необходимого уровня.
Буква «Р» в кругеГорит, если отключен ручной тормоз.
АккумуляторСветится, если разряжена аккумуляторная батарея.
Восклицательный знак в кругеГорит красным, если недостаточный уровень тормозной жидкости.

Кнопки на приборной панели

Кнопки также имеют определенное месторасположение в схеме расположения АП.

Кнопки управления на ВАЗ 2114

Каждая из них имеет свое предназначение:

  1. Кнопка, расположенная справа от спидометра, дает возможность на электронном дисплее переключать время и температуру. Если на нее жать более 5 секунд, когда автомобиль находится в покое, сбросятся текущие показания пробега.
  2. Справа над спидометром на щитке находится комбинация двух кнопок. С помощью кнопки с изображением 2-х фар включаются габаритные огни. Кнопка с одной фарой служит для включения ближнего света.
  3. Кнопка, на которой изображена фара с наклонными штрихами, предназначена для включения передних противотуманок.
  4. Кнопка с горизонтальными штрихами, служит для включения задних противотуманок.
  5. Кнопка с прямоугольником позволяет включить функцию, благодаря которой будет обогреваться заднее стекло.

Разобраться со всеми индикаторами, АП и кнопками несложно, имея схему расположения в мануале автомобиля. Данная статья помогает разобраться со всеми обозначениями.

Подводя итоги, можно сказать, что на панели АП отражается следующая полезная информация:

  • технические характеристики транспортного средства, степень его безопасности на момент движения;
  • наличие бензина, уровень рабочих жидкостей;
  • информация о динамике движения: скорости, оборотах коленвала и др.;
  • эксплуатации различных приборов автомобиля;
  • прочая полезная информация, например время, температура и др.

Светодиодная панель приборов ВАЗ 2114

Получить данную информацию позволяют различные датчики и измерительные приборы, входящие в электрическую схему машины. Так как конструкция и схема подключения АП проста, ее легко разбирать и собирать. Поэтому, если есть желание, можно выполнить тюнинг, произвести накладку, вставки дополнительных элементов, можно сделать подсветку из светодиодов.

Если на приборной панели начинают подсвечиваться какие-либо индикаторы, следует сразу реагировать на это. Вовремя обнаруженная и устраненная неисправность даст возможность избежать проблем в пути и продлит эксплуатационный срок автомобиля.

Видео «Замена лампочек на приборной панели ВАЗ 2114»

Видео Алексея Львова о том, как снять приборную панель и заменить лампочки.

 Загрузка …

обозначение кнопок и тюнинг приборки

Приборная панель ВАЗ 2114 – главный информационный блок, на которой отображаются данные о текущем функциональном состоянии автомобиля. Расположена она на торпеде, прямо перед сидением водителя.

Приборка ВАЗ 2114, 2113,2115

На самой панели находится  элементы трех видов:

  • Лампочки-индикаторы, свидетельствующие о количестве необходимых для работы автомобиля расходных элементов – бензина, масла, тормозной жидкости и тд;
  • Спидометр и тахометр;
  • Управляющий элемент для переключения режима работы спидометра.

Также к понятию «комбинация приборов» принято относить рычаги включения поворотников, кнопки для управления фарами, печкой, и другими коммуникациями машины.

Схема приборной панели ВАЗ 2114 выглядит следующим образом:

Панель приборов (схема)

Из данной статьи вы узнаете обозначение значков на приборной панели ВАЗ 2114, причины загорания индикаторов, а также меры, которые необходимо принять для устранения возникших неполадок.

  • ОСНОВНЫЕ ЭЛЕМЕНТЫ ПАНЕЛИ
  • ИНДИКАТОРНЫЕ ЛАПОЧКИ
  • КНОПКИ НА ПРИБОРНОЙ ПАНЕЛИ

Основные приборы и их расшифровка

Разумеется, наиболее значимыми приборами на приборной панели являются:

  • Спидометр;
  • Тахометр;
  • Указатель температуры ОЖ;
  • Указатель уровня топлива в баке.

Комбинация приборов

Давайте детальнее их изучим.

  1. Спидометр. На ВАЗ 2114 предусматривается установка индукционного спидометра, который получает данные о скорости благодаря датчику, расположенному на коробке передач. Спидометр показывает текущую скорость движения автомобиля. Шкала разбита от 0 до 200 километров в час с шагом 10 километров в час. Подобные устройства имеют погрешность минимум 5 километров в час. Внизу по центру спидометра расположен дисплей с двумя строками. Она сообщает о текущем пробеге, а вторая — об общем пробеге, совершенном на этом автомобиле.
  2. Тахометр. Он находится слева от спидометра. Тахометр является электронным прибором, который получает сигналы от бортового компьютера и отражает текущие обороты коленчатого вала. Шкала выполнена с делением в 5 единиц. Оцифровка — через каждые 10 единиц шкалы. Максимальная шкала тахометра — 80. Умножив это число на 100, мы получаем количество оборотов. К примеру, если на шкале 40, тогда коленвал крутится 4000 оборотов в минуту. Диапазон от 55 до 60 имеет красную заштриховку, а 80 полностью окрашен в красный. Это критические обороты, при дохождении стрелки до которых двигатель работает в экстремальных нагрузках и может выйти из строя. Внизу тахометра посередине отображается время и температура воздуха.
  3. Указатель температуры ОЖ. За температурой охлаждающей жидкости следует постоянно следить, потому для этого на приборной панели предусмотрен соответствующий указатель. Он размещен слева от тахометра, сообщает о текущей температуре жидкости охлаждения. Данные поступают с соответствующего датчика. Деление выполнено с шагом 20 градусов. Оцифровка стартует от 50, затем идет 90 и 130. Опасная зона начинается с отметки 105 градусов. Если стрелка оказывается в этой зоне, двигатель нужно немедленно остановить, иначе возникнет перегрев и поломка.
  4. Указатель уровня топлива. Он располагается справа от спидометра. На шкале указываются цифры и изображения, которые означают:

    1. 0 — бак пустой;
    2. 1/2 — бак заполнен наполовину;
    3. бак полный;
    4. Изображение бензоколонки вверху — бак заполнен максимально;
    5. Изображение бензоколонки снизу справа с оранжевой подсветкой — в баке осталось менее 6 литров топлива.

Индикаторные лапочки

Обозначения на приборной панели ВАЗ 2114 сделаны согласно требованиям и нормам. Они унифицированы для того, чтобы были понятны всем водителям. Обозначения индикаторов расположены в нижней части щитка.

Тюнинг панели приборов ВАЗ 2114

В таблице дается описание обозначений, которые используются в схемах и на приборной панели.

ИзображениеОбозначение
Канистра с каплейСигнализирует, что уровень масла в катере ДВС опустился ниже минимально допустимого, горит значок красным цветом.
Дворники и фонтанчикСообщает о том, если остаток омывающей жидкости в бачке составляет меньше одного литра. Индикатор начинает светиться оранжевым цветом.
ТермометрСветится оранжевым цветом, если в расширительном бачке недостаточный уровень охлаждающей жидкости.
Авто с открытыми дверьмиГорит красным цветом, если не закрыта одна из дверей.
Значок перечеркнутой лампочкиОзначает, что есть проблемы со стоп-сигналами или габаритами.
Круг с черточками по бокамСигнализирует об износе колодок тормозной системы и неисправностях тормозов.
Человечек с ремнями безопасностиСообщает, что водитель или один из пассажиров не использует ремни безопасности.
Две зеленые стрелки вверху щиткаЗагораются соответствующие лампочки при включении правого или левого поворотника.
Красный треугольникЗагорается при аварийной остановке.
Check EngineСигнализирует о неполадках с двигателем. Горит красным цветом.
Синяя лампочкаГорит при включении дальнего света
Зеленая лампочкаГорит при включении света ближнего
Обозначения, относящиеся к более ранним версия ВАЗ 2114
Канистра с каплей жидкости красного цветаЗагорается, если давление масла не отвечает требованиям, то есть падает ниже необходимого уровня.
Буква «Р» в кругеГорит, если отключен ручной тормоз.
АккумуляторСветится, если разряжена аккумуляторная батарея.
Восклицательный знак в кругеГорит красным, если недостаточный уровень тормозной жидкости.

Распиновка

Распиновка панели приборов ВАЗ 2114 показывает правильный порядок подключения проводов измерительных и информационных устройств, иными словами, это электронная схема щитка приборов. Она понадобится, если вы захотите внести какие-либо изменения в стандартную конфигурацию панели или провести ремонт и замену деталей. Для каждой модели автомобиля и конкретной приборной панели схема будет немного отличаться, к примеру, схема на ВАЗ 2115 имеет существенные отличия от модели 2114.

Схема состоит из 26 подключений, которые выполнены по электронной схеме. Обычно схема должна идти в комплекте с руководством для автомобиля. Описание ее работы сейчас раздобыть не проблема.

Внутри панели есть две колодки — одна красная и одна белая. К ним и будет производиться подключение приборов в определенной последовательности.

Ничего сложного в распиновке нет, если пользователь обладает базовыми знаниями о правилах подключения проводов — плюс к плюсу, минус к минусу. Если на руках есть схема панели приборов, можно заняться тюнингом отдельных устройств или всего комплекта, чтобы приборная панель 2114 модели стала приятней в плане визуального восприятия.

Заключение

Помните о том, что приборная панель — это связующее устройство между автовладельцем и машиной. Поэтому автолюбитель должен понимать, о чем сигнализируют те или иные индикаторы.

ИНДИКАТОРНЫЕ ЛАПОЧКИ

Также панель приборов на ВАЗ 2114 имеет блок световых индикаторов, который включает следующие значки:

Индикаторы

Разберем обозначение значков на панели приборов детальнее:

  1. Индикатор, выводящий информацию о текущем уровне масла в двигателе. При критически низком количестве смазывающей жидкости лампочка загорается оранжевым цветом. Масло необходимо долить сразу же после того, как этот индикатор станет активным;
  2. Данный индикатор свидетельствует о низком количестве рабочей жидкости в емкости стеклоомывателя. Бачек рассчитан на 5 литров жидкости, индикатор включается, когда её количество падает ниже 1 литра;
  3. Датчик количества жидкости в системе охлаждения двигателя. Один из важнейших индикаторов, за которым необходимо тщательно следить;
  4. Указывает на наличие незакрытых дверей. Горит красным цветом;
  5. Индикатор, который загорается, если габариты, либо стоп-сигнальные лампы вышли из строя. Цвет активного индикатора – красный;
  6. Лампочка, которая загорается в случае критического износа тормозных колодок (1.5 мм). Горит с момента первого нажатия тормозов до выключения автомобиля;
  7. Индикатор, свидетельствующий о том, что водитель не пристегнут ремнями безопасности.

Восклицательный знак на панели приборов ВАЗ 2114 может гореть в двух случаях: при включенной стартере автомобиля, и при низком уровне тормозной жидкости. Как правило, причина во втором варианте.

Для устранения проблемы полностью заполните бачек и проверьте контакты датчика уровня ТЗ, которые расположены на крышке емкости, на предмет окисления.

Если горит значок двигателя на панельке, значит с силовым агрегатом четырнадцатой что-то не в порядке. Причин у загорания лампочки «Check Engine» очень много, нередко она горит даже тогда, когда каких-либо видимых неисправностей нет. Лучше всего съездить в СТО на диагностику, так вы обезопасите от возможных проблем.

Лампочки, индикаторы значки

Имея перед собой фото значков, разобраться в их обозначении на панели приборов ВАЗ 2114 будет намного проще.

Значки выполнены в строгом соответствии с нормами и требованиями, что позволяет разобраться в их обозначении вне зависимости от модели, производителя. Все автомобильные компании должны унифицировать обозначения. Это позволяет понять их суть каждому водителю.

Обозначение значков

На ВАЗ 2114 с инжекторным двигателем последних версий обозначения находятся в нижней части приборной панели. Предлагаем соответствующую таблицу с расшифровками.

ИзображениеОбозначение
Значок канистры с каплей жидкостиИзображение сообщает о снижении уровня масла в картере двигателя ниже допустимого, подсвечивается красным
Значок дворников и фонтанчикаСообщает о недостаточном количестве омывающей жидкости. Если омывателя остается меньше литра, значок загорается оранжевым
Значок термометраГоворит о снижении уровня охлаждающей жидкости в расширительном баке на холодном двигателе ниже допустимого. Загорается оранжевым цветом
Значок машины с открытыми дверьмиСообщает о том, что какие-то из дверей не закрыты. Подсвечивается красным
Значок перечеркнутой лампочкиСообщает о неисправности габаритов или стоп-сигналов
Значок круга со штрихами по бокамГоворит о неисправности тормозов, выработке колодок
Значок человека с ремнями безопасностиСообщает о том, что кто-то не пристегнул ремни.
Значок двух зеленых стрелокСигнализируют о включении левого или правого поворотника
Значок Check EngineЗагорается красным при возникновении неполадок двигателя
Значок синей лампочкиГоворит о включенном дальнем свете
Значок зеленой лампочкиГоворит о включении ближнего света.
Обозначения, предусмотренные на ВАЗ 2114 более ранних модификаций
Красный значок канистры с каплей жидкостиСигнализирует о падении масла, означает аварийное давление масла
Значок буквы «Р» в кружочкеСигнализирует о не выключенном ручном тормозе
Изображение аккумулятораВключается при разрядке аккумуляторной батареи

Значок восклицательного знака в кружке

 

Загорается красным, сообщает о снижении уровня тормозной жидкости.

Кнопки на приборной панели

Кнопки также имеют определенное месторасположение в схеме расположения АП.

Кнопки управления на ВАЗ 2114

Каждая из них имеет свое предназначение:

  1. Кнопка, расположенная справа от спидометра, дает возможность на электронном дисплее переключать время и температуру. Если на нее жать более 5 секунд, когда автомобиль находится в покое, сбросятся текущие показания пробега.
  2. Справа над спидометром на щитке находится комбинация двух кнопок. С помощью кнопки с изображением 2-х фар включаются габаритные огни. Кнопка с одной фарой служит для включения ближнего света.
  3. Кнопка, на которой изображена фара с наклонными штрихами, предназначена для включения передних противотуманок.
  4. Кнопка с горизонтальными штрихами, служит для включения задних противотуманок.
  5. Кнопка с прямоугольником позволяет включить функцию, благодаря которой будет обогреваться заднее стекло.

Разобраться со всеми индикаторами, АП и кнопками несложно, имея схему расположения в мануале автомобиля. Данная статья помогает разобраться со всеми обозначениями.

Подводя итоги, можно сказать, что на панели АП отражается следующая полезная информация:

  • технические характеристики транспортного средства, степень его безопасности на момент движения;
  • наличие бензина, уровень рабочих жидкостей;
  • информация о динамике движения: скорости, оборотах коленвала и др.;
  • эксплуатации различных приборов автомобиля;
  • прочая полезная информация, например время, температура и др.

Светодиодная панель приборов ВАЗ 2114

Получить данную информацию позволяют различные датчики и измерительные приборы, входящие в электрическую схему машины. Так как конструкция и схема подключения АП проста, ее легко разбирать и собирать. Поэтому, если есть желание, можно выполнить тюнинг, произвести накладку, вставки дополнительных элементов, можно сделать подсветку из светодиодов.

Если на приборной панели начинают подсвечиваться какие-либо индикаторы, следует сразу реагировать на это. Вовремя обнаруженная и устраненная неисправность даст возможность избежать проблем в пути и продлит эксплуатационный срок автомобиля.

Главные информационные устройства

Панели приборов ВАЗ 2114 показывают информацию о состоянии важных рабочих узлов авто. Основная часть — информационный блок с двумя круглыми шкалами и несколькими индикаторами поменьше.

  1. Спидометр — это правая круглая шкала на панели с отметками от 0 до 200 км/ч, которая показывает скорость движения авто. Датчик устройства расположен в узле коробки передач и связан с дисплеем в салоне. Под шкалой размещено окошко, в котором отображается пробег автомобиля.
  2. Индикатор справа от спидометра — уровень бензина в баке. Имеет три основных деления — 1, ½ и 0. Единица — бак полон, ноль — пустой. Когда топливо на исходе, загорается оранжевый значок заправки.
  3. Тахометр — вторая крупная круглая шкала, которая размещена слева на панели. Отображает информацию о скорости вращения коленвала — работе двигателя. Норма его — 3500-5500 оборотов в минуту, все, что дальше, — критическое значение, при котором возникают поломки узла двигателя. Индикатор под шкалой отображает температуру воздуха вокруг движка.
  4. Небольшой индикатор слева от тахометра — датчик температуры жидкости для охлаждения. Значения от 50 до 130°С, где значение в 105°С и выше обозначает возможный перегрев двигателя.

Видео «Как изменить цвет подсветки контрольного щитка?»

Инструкция на тему изменения подсветки в приборке «Четырки» приведена в ролике ниже (автор — канал By гараж #229).

Органы управления и оборудование салона ВАЗ 2113 | 2114 | 2115

2. Органы управления, приборная панель и оборудование салона

Органы управления

Панель, устанавливаемая при сборке на заводе заз: 1. левый боковой дефлектор, 2. левый дефлектор обдува боковых окон, 3. подрулевой переключатель управления наружным освещением и указателями поворотов, 4. рулевое колесо, 5. комбинация приборов, 6. кнопка подачи звукового сигнала, 7. кнопка аварийной световой сигнализации, 8. подрулевой переключатель управления стеклоочистителям и иомывателями, 9. выключатель наружного освещения, 10. выключатель передних противотуманных фар(опция), 11. заглушка(гнездо под кнопку дополнительного оборудования), 12. выключатель задних противотуманных фонарей, 13. выключатель подогрева заднего окна, 14. бортовой компьютер «multitronics»(опция), 15. панель приборов, 16. панель индикаторов, 17. перчаточный ящик, 18. правый дефлектор обдува боковых окон, 19. правый боковой дефлектор, 20. рычаг отпирания капота, 21. корректор фар, 22. регулятор подсветки приборов, 23. замок зажигания, 24. педаль сцепления, 25. педаль тормоза, 26. педаль акселератора, 27. заглушка, 28. прикуриватель, 29. отсек для мелких предметов, 30. рычаг переключения передач, 31. кнопка подогрева водительского сиденья(опция), 32. рычаг стояночного тормоза, 33. кнопка подогрева сиденья переднего пассажира(опция), 34. пепельница, 35. ниша для установки радиоприемника или магнитолы, 36. панель управления отопителем и вентиляцией салона, 37. центральный дефлектор, 38. журнальная полка, 39. предупредительный индикатор недостаточного уровня моторного масла в картере двигателя, 40. предупредительный индикатор недостаточного уровня жидкости в бачке стеклоомывателя, 41. предупредительный индикатор падения уровня охлаждающей жидкости, 42. индикатор незакрытой двери, 43. предупредительный индикатор выхода из строя ламп сигнальных огней, 44. предупредительный индикатор износа тормозных накладок передних колес, 45. предупредительный сигнал о непристегнутом ремне безопасности, 46. кнопка омывателя фар(опция), 47. заглушка(гнездо под кнопку дополнительного оборудования), 48. указатель температуры охлаждающей жидкости, 49. тахометр, 50. индикатор левого указателя поворота, 51. индикатор правого указателя поворота, 52. спидометр, 53. указатель уровня топлива, 54. индикатор резервного остатка топлива, 55. индикатор низкого давления асла, 56. индикатор затяжки стояночного тормоза, 57. индикатор системы зарядки, 58. дисплей отображения часов и температуры, 59. предупредительный индикатор «проверьте двигатель», 60. индикатор аварийнойсветовой сигнализации, 61. дисплей одометра и счетчика суточного пробега, 62. кнопка сброса счетчика суточного пробега, 63. индикатор дальнего света фар головного освещения, 64. предупредительный индикатор аварийного состояния рабочей тормозной системы, 65. индикатор включения габаритного света.

Спидометр
Указывает приблизительную скорость движения автомобиля (в км/ч).
Одометр
Служит для отображения суммарного пробега автомобиля (в км).
Счетчик суточного пробега
Счетчик суточного пробега позволяет определить пробег автомобиля за отдельный промежуток времени (например, за время последней поездки). Для сброса значений счетчика суточного пробега используется специальная кнопка сброса.
Примечание
Сброс счетчика суточного пробега осуществляется только на неподвижном автомобиле.
Тахометр
Показывает приблизительную частоту вращения коленчатого вала двигателя (в оборотах в минуту). Для получения значения частоты вращения необходимо число на шкале, на которое указывает стрелка, умножить на 100.
Красная зона (участок шкалы, заштрихованный красным) означает режим работы двигателя на повышенной частоте, что является опасным для двигателя.
Внимание
Не допускайте такого режима работы двигателя, при котором стрелка тахометра находится в красной зоне (более 6000 об/мин).

Указатель температуры охлаждающей жидкости
Переход стрелки данного указателя в красную зону шкалы указывает на перегрев двигателя. В этом случае проверьте работу термостата и электровентилятора системы охлаждения.
Внимание
Не допускайте, чтобы двигатель работал в режиме перегрева (свыше 110°С).

Указатель уровня топлива
При включении зажигания данный указатель отображает приблизительное количество топлива в баке. Если топливо в баке почти заканчивается (осталось менее 7-9.5 литров), стрелка приближается к значению «0» на шкале и загорается соответствующий световой индикатор предупреждающий о необходимости заправки. В этом случае рекомендуется заправиться топливом как можно скорее.
Эконометр
Данный указатель предназначен для того, чтобы помочь водителю выбрать наиболее экономичный режим работы двигателя. Шкала эконометра разделена на две зоны — белую и желтую. Белая зона соответствует экономичному режиму, желтая — режиму высокого расхода топлива.
Индикаторы указателей поворотов
При включении указателей поворотов, данный индикатор начинает мигать на панели приборов. В случае если индикатор мигает слишком часто, это указывает на возможное перегорание ламп указателей поворотов. Необходимо заменить перегоревшую лампу новой.
Индикатор включения габаритного света
Данный индикатор загорается при включении наружного освещения автомобиля.
Индикатор дальнего света фар
Данный индикатор загорается синим светом при включении дальнего света фар.
Предупредительный сигнал «STOP»
Данный световой сигнал может загораться одновременно с одним из следующих индикаторов. Если загорелся данный предупредительный сигнал, необходимо немедленно остановить автомобиль в безопасном месте и принять меры к поиску и устранению неисправности. Дальнейшее движение на автомобиле с зажженным предупредительным сигналом «STOP» небезопасно.
Предупредительный индикатор аварийного состояния рабочей тормозной системы
Загорается красным светом при понижении уровня тормозной жидкости в расширительном бачке главного тормозного цилиндра ниже метки «MIN».
Внимание
При загорании индикатора во время движения автомобиля, дальнейшее движение запрещено до устранения причин неисправности.

Индикатор затяжки стояночного тормоза
Индикатор загорается красным светом при активации стояночного тормоза.
Индикатор незакрытой двери
Данный индикатор загорается в случае, если одна или несколько дверей автомобиля не закрыты или закрыты неплотно.
Предупредительный сигнал о непристегнутом ремне безопасности
Данный световой сигнал загорается на панели приборов в случае, если при работающем двигателе ремень безопасности водителя не пристегнут.
Индикатор включения аварийной сигнализации
Данный индикатор загорается одновременно с включением аварийной световой сигнализации.
Индикатор системы зарядки
Данный индикатор загорается красным светом при включении зажигания и гаснет после пуска двигателя. Яркое загорание лампы или ее свечение в полсилы при работающем двигателе указывает на слабое натяжение (обрыв) ремня привода генератора или на неисправность в цепи системы зарядки.
Индикатор низкого давления масла
Данный индикатор загорается красным светом в случае падения давления масла в двигателе.
Внимание
Движение автомобиля при горящем индикаторе низкого давления масла может привести к серьезным повреждениям двигателя.

Предупредительный индикатор «проверьте двигатель»
Примечание
Только для автомобилей с системой непосредственного впрыска топлива.

Кратковременное загорание индикатора при включении зажигания свидетельствует о самодиагностике системы и при отсутствии неисправности индикатор гаснет. В случае обнаружения неисправности в системе, индикатор мигает или горит постоянно.
Внимание
Движение с горящим индикатором «Проверьте двигатель» запрещено.

Индикатор включения задних противотуманных фонарей.
Данный индикатор загорается при включении задних противотуманных фонарей.
Индикатор подогрева заднего стекла.
Данный индикатор включается после нажатия кнопки включения подогрева заднего стекла и гаснет при повторном нажатии.
Предупредительный индикатор выхода из строя ламп сигнальных огней (опция)
Данный индикатор загорается в случае перегорания ламп стоп-сигналов, габаритных огней или указателей поворотов.
Предупредительный индикатор падения уровня охлаждающей жидкости (опция)
Данный индикатор загорается при понижении уровня охлаждающей жидкости на холодном двигателе ниже допустимого предела.
Примечание
Перед тем, как долить охлаждающую жидкость в систему, необходимо убедиться в отсутствии утечек.

Предупредительный индикатор износа тормозных накладок передних колес (опция)
Данный индикатор загорается при нажатии на педаль тормоза при включенном зажигании и горит до выключения зажигания в случае, если толщина накладок тормозных колодок передних колес достигла значения 1.5 мм. В этом случае необходимо заменить тормозные колодки новыми.
Предупредительный индикатор недостаточного уровня жидкости в бачке стеклоомывателя (опция)
Данный индикатор загорается в случае, если в бачке стеклоомывателя остается менее одного литра омывающей жидкости.
Предупредительный индикатор недостаточного уровня моторного масла в картере двигателя (опция)
Данный индикатор загорается в случае, если уровень моторного масла в картере двигателя достиг предельно допустимого минимума.
Примечание
Перед тем, как долить масло в двигатель, убедитесь в отсутствии утечек.

Индикатор прикрытия воздушной заслонки карбюратора

Примечание
Только для автомобилей с карбюраторными двигателями.

Данный индикатор загорается при использовании принудительного прикрытия дроссельной заслонки для облегчения пуска двигателя.

Обозначение значков на панели приборов ВАЗ 2114 [ОТВЕЧЕНО]

Обозначение значков на панели приборов ВАЗ 2114

Марка автомобиля

ВАЗ ЛАДА 2114

Вопрос

Что означают индикаторы на приборной панели ВАЗ 2114? Опишите пожалуйста. 

Ответ

Приборная панель на «четырнадцатой» достаточно компактная, при этом с минимумом индикаторов. Разобраться в каждом из них просто, но для новичков рекомендуем изучить каждое из имеющихся обозначений. В этом поможет картинка и следующий список:

  1. Шкала температуры охлаждающей жидкости. Представлен разбег температур от 50 до 120 градусов. Переход стрелки в красный сектор сигнализирует о перегреве мотора. Требуется дальнейшая диагностика и определение причины.
  2. Тахометр. Показывает, с какой частотой вращается коленчатый вал. Красная зона информирует о превышении нормы. Не рекомендуется доводить обороты до этих значений.
  3. Мигающий индикатор зеленой стрелки говорит о включении левого сигнала поворота.
  4. Мигающий индикатор зеленой стрелки говорит  о включении правого  поворотника.
  5. Спидометр. Показывает скорость движения транспортного средства в километрах в час (шкала до 200 км/ч).
  6. Индикатор наполненности топливного бака.
  7. Индикатор «заправка» говорит о малом количестве топлива. Загорается, когда в баке остается приблизительно 6-7 литров.
  8. Индикатор «лампочки » говорит  о включении габаритов. Горит только при работающем наружном свете.
  9. Индикатор «красный знак восклицания». Показывает неудовлетворительное состояние системы торможения, в частности, при низком уровне тормозной жидкости. Не допускается эксплуатация авто с горящим индикатором.
  10. Индикатор «фара» говорит о работающем дальнем свете.
  11. Кнопка сброса пробега до нуля и установки часов.
  12. Счетчик километража. Верхнее число – это общий пробег транспортного средства, а нижнее – пробег за сутки.
  13. Иконка «красный треугольник» говорит о включении аварийного сигнала.
  14. Значок «двигателя» (CHECK ENGINE). В исправном состоянии машины единожды загорается при включении зажигания и моментально гаснет. Мигает или горит, если один из датчиков в моторе зафиксировал неисправность или некорректные данные.
  15. Индикатор времени и температуры.
  16. Иконка «аккумулятор» говорит о низком заряде АКБ. В нормальном режиме единожды загорается и тухнет после зажигания. Если горит постоянно, необходима диагностика и проверка генератора или других компонентов системы.
  17. Индикатор «Р в кружочке» показывает состояние ручного тормоза. Загорается, если рычаг поднят вверх.
  18. Индикатор «масленки» начинает светиться, когда давление масла в системе критически низкое.
  19. Положение воздушной заслонки (на авто с карбюратором).

Это все обозначения в стандартной панели Lada 2114.

Смотрите также

Панель приборов ВАЗ 2114: обозначения значков и описание кнопок (фото)

Содержание:

  1. Основные приборы и их расшифровка
  2. Лампочки, индикаторы значки
  3. Кнопки и их обозначение

Приобретая себе новый или подержанный автомобиль, первым делом владелец должен разобраться в том, как именно управлять машиной и всеми ее системами. Для этого следует знать распиновку панели приборов на ВАЗ 2114, поскольку именно об этом автомобиле мы сегодня говорим.

Панель приборов

Предлагаем вашему вниманию подробное описание кнопок на приборной панели ВАЗ 2114, значков, лампочек и прочих приборов и индикаторов.

Основные приборы и их расшифровка

Разумеется, наиболее значимыми приборами на приборной панели являются:

  • Спидометр;
  • Тахометр;
  • Указатель температуры ОЖ;
  • Указатель уровня топлива в баке.

Комбинация приборов

Давайте детальнее их изучим.

  1. Спидометр. На ВАЗ 2114 предусматривается установка индукционного спидометра, который получает данные о скорости благодаря датчику, расположенному на коробке передач. Спидометр показывает текущую скорость движения автомобиля. Шкала разбита от 0 до 200 километров в час с шагом 10 километров в час. Подобные устройства имеют погрешность минимум 5 километров в час. Внизу по центру спидометра расположен дисплей с двумя строками. Она сообщает о текущем пробеге, а вторая — об общем пробеге, совершенном на этом автомобиле.
  2. Тахометр. Он находится слева от спидометра. Тахометр является электронным прибором, который получает сигналы от бортового компьютера и отражает текущие обороты коленчатого вала. Шкала выполнена с делением в 5 единиц. Оцифровка — через каждые 10 единиц шкалы. Максимальная шкала тахометра — 80. Умножив это число на 100, мы получаем количество оборотов. К примеру, если на шкале 40, тогда коленвал крутится 4000 оборотов в минуту. Диапазон от 55 до 60 имеет красную заштриховку, а 80 полностью окрашен в красный. Это критические обороты, при дохождении стрелки до которых двигатель работает в экстремальных нагрузках и может выйти из строя. Внизу тахометра посередине отображается время и температура воздуха.
  3. Указатель температуры ОЖ. За температурой охлаждающей жидкости следует постоянно следить, потому для этого на приборной панели предусмотрен соответствующий указатель. Он размещен слева от тахометра, сообщает о текущей температуре жидкости охлаждения. Данные поступают с соответствующего датчика. Деление выполнено с шагом 20 градусов. Оцифровка стартует от 50, затем идет 90 и 130. Опасная зона начинается с отметки 105 градусов. Если стрелка оказывается в этой зоне, двигатель нужно немедленно остановить, иначе возникнет перегрев и поломка.
  4. Указатель уровня топлива. Он располагается справа от спидометра. На шкале указываются цифры и изображения, которые означают:
    1. 0 — бак пустой;
    2. 1/2 — бак заполнен наполовину;
    3. бак полный;
    4. Изображение бензоколонки вверху — бак заполнен максимально;
    5. Изображение бензоколонки снизу справа с оранжевой подсветкой — в баке осталось менее 6 литров топлива.

Лампочки, индикаторы значки

Имея перед собой фото значков, разобраться в их обозначении на панели приборов ВАЗ 2114 будет намного проще.

Значки выполнены в строгом соответствии с нормами и требованиями, что позволяет разобраться в их обозначении вне зависимости от модели, производителя. Все автомобильные компании должны унифицировать обозначения. Это позволяет понять их суть каждому водителю.

Обозначение значков

На ВАЗ 2114 с инжекторным двигателем последних версий обозначения находятся в нижней части приборной панели. Предлагаем соответствующую таблицу с расшифровками.

ИзображениеОбозначение
Значок канистры с каплей жидкостиИзображение сообщает о снижении уровня масла в картере двигателя ниже допустимого, подсвечивается красным
Значок дворников и фонтанчикаСообщает о недостаточном количестве омывающей жидкости. Если омывателя остается меньше литра, значок загорается оранжевым
Значок термометраГоворит о снижении уровня охлаждающей жидкости в расширительном баке на холодном двигателе ниже допустимого. Загорается оранжевым цветом
Значок машины с открытыми дверьмиСообщает о том, что какие-то из дверей не закрыты. Подсвечивается красным
Значок перечеркнутой лампочкиСообщает о неисправности габаритов или стоп-сигналов
Значок круга со штрихами по бокамГоворит о неисправности тормозов, выработке колодок
Значок человека с ремнями безопасностиСообщает о том, что кто-то не пристегнул ремни.
Значок двух зеленых стрелокСигнализируют о включении левого или правого поворотника
Значок Check EngineЗагорается красным при возникновении неполадок двигателя
Значок синей лампочкиГоворит о включенном дальнем свете
Значок зеленой лампочкиГоворит о включении ближнего света.
Обозначения, предусмотренные на ВАЗ 2114 более ранних модификаций
Красный значок канистры с каплей жидкостиСигнализирует о падении масла, означает аварийное давление масла
Значок буквы «Р» в кружочкеСигнализирует о не выключенном ручном тормозе
Изображение аккумулятораВключается при разрядке аккумуляторной батареи

Значок восклицательного знака в кружке

 

Загорается красным, сообщает о снижении уровня тормозной жидкости.

Кнопки и их обозначение

Теперь переходим непосредственно к кнопкам, которые также имеют свое законное место на приборной панели ВАЗ 2114.

  1. Кнопка справа снизу относительно спидометра позволяет переключать температуру и время на цифровом дисплее. Если зажать ее на 5 секунд при стоящем автомобиле, сбросятся текущие данные пробега.
  2. Сдвоенная кнопка с двумя переключателями. Кнопка с двумя фарами включает габариты, а кнопка с одной фарой — включает ближний свет.
  3. Кнопка с нарисованными под углом штрихами и фарой включает передние противотуманные фары.
  4. Кнопка с горизонтальными штрихами включает задние противотуманные фары.
  5. Кнопка с прямоугольником включает обогрев заднего стекла.

На деле разобраться во всех кнопках, индикаторах и указателях не сложно. Наше описание кнопок приборной панели ВАЗ 2114 позволит в этом разобраться. Но лучше всего сесть в автомобиль вместе с инструкцией и наглядно во всем убедиться.

Ни в коем случае не игнорируйте сообщения приборной панели. Если своевременно отреагировать на сигнал о пустеющем баке, к примеру, вы сможете вовремя завернуть на заправку и не заглохнуть посреди дороги.

 Загрузка …


Сигнальные лампы ВАЗ 2114. Подготовка к замене лампочек на панели приборов

Поиск возможных причин, почему не работает приборная панель ВАЗ 2114 периодически беспокоит того или иного владельца автомобилей данной модели. Конечно, если вы не видите на дашборде ни одного параметра, можно, как говорится, пройти только наощупь. Правда, известны некоторые специалисты, которым все же удалось как-то без всяких показаний доползти до базы, но как-то не хочу следовать их примеру.

А нужно ли создавать дополнительные неприятности и риск аварии на дороге? Так что большинство из тех, с кем произошло это происшествие, тем не менее добираются до работы (или куда они там собирались) на общественном транспорте, чтобы вечером вернуться к решению проблемы самостоятельно или с помощью знакомого автосервиса.

Почему не работает панель приборов ВАЗ 2114? Навскидку, можно назвать сразу несколько причин. Однако не исключено, что ими не исчерпывается весь список, так как могут проявиться индивидуальные особенности автомобиля.Об этом и многом другом, не менее интересном, мы постараемся рассказать сегодня в нашей статье.

Наиболее частая поломка

Перед тем, как копаться в салоне автомобиля, проверьте, насколько надежно закреплен провод массы, ведущий к передней панели. Неугомонный пассажир впереди часто просто ногами тянет его с места. Чтобы ситуация не повторилась, после крепления стоит изолировать провод от досягаемости.
Ситуация немного сложнее

Ее симптомы очень характерны:

  • Стрелки не работают все: спидометр, тахометр, одометр, самописец уровня топлива;
  • Остальной комплект оборудования — оптика, магнитола, даже подсветка панели включена нормально и не прихотлива;
  • Зажигание в режиме срабатывания, машина не отказывается заводиться;
  • Почти 100% f3 Перегорел предохранитель .Он находится в монтажном блоке, необходимо его поменять. Но для начала нужно узнать, почему он накрылся, иначе новый набор постигнет та же участь. В большинстве случаев виновато выгорание. короткое замыкание. На хорошо отработанных ВАЗ-2114 после каждой мойки. Вместо того, чтобы брать с собой запасной, нужно выяснить, откуда берется влага.

Если предохранитель исправен, это не повод сразу оставлять его в покое. Не лишним будет снять его и проверить контакты: с предохранителем под напряжением, а с окисленными клеммами цепь прервется, и приборка перестанет подавать какие-либо признаки жизни.

Следующее слабое звено: Реле зажигания. Он расположен слева от рулевой колонки, закреплен на шпильке, так сказать, вверх ногами. Вам нужно удалить его и попытаться напрямую соприкоснуться с проводами. При явных признаках восстановления на панели приборов сразу становится понятно, что пора менять реле.

Жесткий футляр

Пока что разобрались ситуации, когда торпеда еще подавала какие-то признаки жизни.Если в приборы добавили неработающие стеклоподъемники, поворотники, дворники, дело уже не в реле и предохранителях.

Может быть 2 варианта:

  • Перегорели контакты зажигания . В принципе, после установки реле (тоже на версии ВАЗ-2109) такая проблема возникает нечасто. Однако вероятность осталась. Замок снимается, контакты проверяются, при необходимости чистятся;
  • Монтажный блок . На его плате могут выгореть гусеницы.Спасет только замена на новый. Однако это не требует затрат места, а установка доступна в самостоятельном исполнении.

Частные ситуации

Общие симптомы не всегда указывают на конкретные поломки. Возможны исключения.

Если отдельные устройства отказываются работать, вполне возможно, что это их личные проблемы. Придется разбирать конкретный указатель. Это могло повредить шестерню, которую следует заменить.

Также почему не работает панель приборов ВАЗ 2114? Если тахометр и указатель уровня топлива трясутся (исправны, никак не реагируют), то контакты и монтажный блок в норме — нужно устроить небольшую проверку.

Нажать и удерживать сброс, параллельно включается зажигание. Восходящие стрелки указывают на необходимость дальнейших поисков. Безжизненный — что в самом щите появились микротрещины. Придется снять его и осмотреть под лупой все припои и дорожки.В принципе, это все базовые варианты. Если прозвон всех перечисленных узлов и деталей не привел к оживлению панели приборов, ваш случай индивидуален, и определять ситуацию вам придется в компании с опытным автомехаником.

Панель приборов автомобиля ВАЗ 2114 является основным информационным блоком автомобиля. Благодаря ему водитель получает информацию о техническом состоянии и работе всех узлов, устройств и датчиков машины, которые отображаются на схемах.В статье рассматриваются основные элементы панели, расшифровка иконок и кнопок дашборда, а также их расположение.


Панели комплектующие

Электронная приборная панель расположена на приборной панели автомобиля, так что водитель может видеть все значки и световые индикаторы. Благодаря тюнингу авто с инжектором пользоваться автоустройствами (АП) стало удобнее. Чтобы эффективно использовать информацию с приборной панели, каждый водитель должен знать ее состав, комбинацию, назначение и расположение всех кнопок и индикаторов.

Основными элементами, расположенными на левой стороне панели, являются:

  1. Спидометр. На ВАЗ 2114 установлен индукционный спидометр, который отображает на дисплее показания текущей скорости, полученные от датчика, расположенного в коробке передач. Шкала устройства разделена на деления по стоимости 10 км / ч и показывает скорость от 0 до 200 км / ч. Для спидометра допускается погрешность в 5 км / ч. Под циферблатом по центру расположены две электронные надписи, отражающие информацию о пробеге автомобиля: общий и текущий.
  2. Тахометр. Рядом со спидометром слева тахометр. Он передает показания числа оборотов коленчатого вала в режиме реального времени. Эти данные он получает с бортового компьютера. Цифры указаны через каждые 10 единиц шкалы. Одно деление равно 5 единицам. Максимально возможное значение — 80 единиц. Чтобы получить количество оборотов коленчатого вала, нужно значение на тахометре умножить на 100. Например, 45 единиц означает, что коленчатый вал совершает 4500 оборотов в минуту.Диапазон от 55 до 60 заштрихован красным, предупреждая, что двигатель работает в тяжелых условиях и может сломаться в любой момент. Под тахометром посередине электроника показывает температуру и время окружающей среды.
  3. Указатель температуры охлаждающей жидкости (охлаждающей жидкости). С левой стороны тахометра отображается показание датчика температуры охлаждающей жидкости, расположенного рядом с термостатом и головкой блока цилиндров. Оцифровка начинается с 50, цена деления — 20 градусов, следующая цифра — 90, максимальное значение — 130 градусов.Если значение находится в диапазоне от 105 до 130 градусов, то нужно остановить движение, выключить мотор и дать ему остыть, иначе мотор может закипеть.
  4. Указатель уровня топлива в бензобаке. Находится на правой стороне спидометра. Каждому из номеров соответствует свое обозначение: 0 — емкость пуста; 1/2 бака наполовину заполнена; 1-полный бак (автор видео ИЗО))) ЛЕНТА).

Вверху есть значок электронной заправки, это означает, что бак полон. В правом нижнем углу такой же электронный значок загорается оранжевым, если в баке осталось менее 6 литров бензина.

Приборная панель не сложная. Если вы хотите, чтобы автомобиль отличался от других, многие используют для этого тюнинг. С его помощью можно сделать интерьер уютным и эффектным. Чаще всего тюнингу подвергается панель приборов, ярче подсветка, выполняются вставки накладок, детали.

Тюнинг приборки ВАЗ 2114

Для того, чтобы произвести настройку подсветки и других частей панели, нужно проделать несложные действия:

  • демонтировать панель;
  • снимаем щиток;
  • произвести тюнинг задуманных деталей, подсветку, вставку дополнительных лампочек и деталей;
  • Верните снятые детали на место.

Тюнинг подсветки заключается в замене желтых индикаторов на яркие светодиоды.

Индикатор лап

Обозначения на панели приборов ВАЗ 2114 выполнены в соответствии с требованиями и стандартами. Они унифицированы, чтобы их могли понять все водители. Обозначения индикаторов расположены внизу экрана.

В таблице описаны символы, используемые на схемах и на приборной панели.

Изображение Обозначение
Падение канистры Сигнализирует, что уровень масла в лодке ICE упал ниже минимально допустимого, значок горит красным.
Дворники и фонтан Сообщает, если остаток омывающей жидкости в бачке меньше одного литра. Индикатор загорится оранжевым.
Термометр Загорается оранжевым светом, если в расширительном бачке недостаточный уровень охлаждающей жидкости.
Открытые двери Загорается красным, если одна из дверей не закрыта.
Значок перечеркнутой лампочки Значит, есть проблемы со стоп-сигналами или габаритами.
Круг со штрихами по бокам Указывает на износ тормозных колодок и неисправности тормозов.
Мужчина с ремнями безопасности Сообщает, что водитель или один из пассажиров не пристегнут ремнями безопасности.
Две зеленые стрелки вверху козырька Соответствующие лампы загораются при включении правого или левого указателя поворота.
Красный треугольник Загорается при аварийной остановке.
Проверить двигатель Сигнализирует о проблемах с двигателем. Горит красным.
Синяя лампочка Загорается при включении дальнего света
Зеленая лампочка Загорается при ближнем свете
Обозначения, относящиеся к более ранней версии ВАЗ 2114
Канистра с каплей красной жидкости Загорается, если давление масла не соответствует требованиям, то есть падает ниже необходимого уровня.
Буква «П» в круге Загорается, когда ручной тормоз отключен.
Аккумулятор Загорается, когда батарея разряжена.
Восклицательный знак в круге Загорается красным, если тормозной жидкости недостаточно.

Кнопки на приборной панели

Кнопки также имеют определенное расположение в макете AP.

Кнопки управления на ВАЗ 2114

Каждая из них имеет свое назначение:

  1. Кнопка, расположенная справа от спидометра, позволяет переключать время и температуру на электронном дисплее.Если вы нажмете ее более 5 секунд, когда автомобиль находится в состоянии покоя, текущий пробег будет сброшен.
  2. Справа над спидометром на приборной панели находится комбинация двух кнопок. Кнопкой с изображением 2-х фар включаются габаритные огни. Кнопка с одной фарой служит для включения ближнего света.
  3. Кнопка, изображающая фару с наклонными штрихами, предназначена для включения передних противотуманных фар.
  4. Кнопка с горизонтальными нажатиями служит для включения задних противотуманных фар.
  5. Кнопка с прямоугольником позволяет включить функцию, благодаря которой будет обогрев заднего стекла.

Работать со всеми индикаторами, точками доступа и кнопками очень просто, их расположение указано в руководстве по эксплуатации автомобиля. Эта статья помогает разобраться во всех обозначениях.

Подводя итог, можно сказать, что на панели AP отображается следующая полезная информация:

  • технические характеристики транспортного средства, степень его безопасности во время движения;
  • наличие бензина, уровень рабочих жидкостей;
  • информация о динамике движения: частота вращения, частота вращения коленчатого вала и др.;
  • работа различных устройств автомобиля;
  • другая полезная информация, такая как время, температура и т. Д.

Светодиодная панель приборов ВАЗ 2114

Получить эту информацию позволяют различные датчики и измерительные приборы, включенные в электрические схемы автомобилей. Поскольку конструкция и схема подключения AP просты, его легко разобрать и собрать. Поэтому при желании можно выполнить настройку, наложение, вставить дополнительные элементы, можно сделать подсветку светодиодов.

Если на приборной панели начали загораться какие-либо индикаторы, нужно немедленно на это отреагировать. Своевременно обнаруженная и устраненная неисправность позволит избежать проблем в пути и продлить срок эксплуатации автомобиля.

Видео «Замена ламп на панели приборов ВАЗ 2114»

Видео Алексея Львова о снятии приборной панели и замене лампочек.

АвтоВАЗ, крупнейший российский производитель легковых автомобилей, пользуется парадоксальной славой среди автомобилистов.Ругая «Ладу» за посредственное качество по сравнению с иномарками, они все же становятся владельцами отечественных автомобилей, что делает ВАЗ самой популярной маркой на российском рынке. Когда во главе концерна не было ни Бо Андерссона, ни технологий Nissan-Renault, самой популярной линейкой продуктов было семейство автомобилей Samara (ВАЗ 2113/2114/2115).

Невыразительный дизайн и бедность оборудования компенсировались грамотным тюнингом, способным буквально преобразить автомобиль. Вариантов тюнинга сегодня очень много.Многие останавливаются на улучшении внешнего вида автомобиля, небольшом рестайлинге экстерьера и легком тюнинге салона.

Остальные идут дальше, «допиливая» практически все системы автомобиля: форсирование двигателя, тюнинг тормозной системы и сцепления, детальную стилизацию кузова и салона, замену и тюнинг панели. В результате получился автомобиль с претензией на комфорт и оригинальность. Доработки хорошо ложатся на все модели семейства Самара. Одним из основных улучшений можно считать тюнинг панели приборов ВАЗ 2114.


Особенности панели приборов Самара

Панель приборов, или приборная панель, помимо основных функций, несет еще и эстетическую, потому что именно на ней устремлены взоры водителей и пассажиров. Поэтому если автовладелец решил провести рестайлинг четырехколесного друга, то тюнинг на панели ВАЗ 2114 просто необходим. Прежде чем приступить непосредственно к настройке панели ВАЗ 2114, следует изучить основные составляющие щита, характеристики и информацию, которую он отображает.

Пятидверный хэтчбек «Самара» стал одним из первых автомобилей Волжского автозавода, на приборной панели которого была установлена ​​электронная комбинация. Подсветка панели приборов ВАЗ 2114 Самара второго поколения осуществляется изнутри, в отличие от предшественника «девятки», где подсветка осуществлялась снаружи. На приборной панели ВАЗ 2114 отображается 19 параметров автомобиля, основными из которых являются спидометр, тахометр, датчики уровня топлива и охлаждающей жидкости.

Стрелка указателя температуры охлаждающей жидкости расположена с левой стороны панели приборов ВАЗ 2114. Красная «зона» начинается при 105 градусах и заканчивается на 130. Если стрелка указателя находится в этой зоне, двигатель необходимо выключить, чтобы он не закипел. За температурной шкалой расположены тахометр, показывающий обороты двигателя, и спидометр.

Последняя шкала справа — указатель уровня топлива. Также на приборной панели ВАЗ 2114 размещены информационные индикаторы, индикаторные указатели, индикаторная лампа включения габаритов, индикатор аварийной сигнализации аварийного состояния рабочей тормозной системы, недостаточного давления масла, включения дальнего света фар, проверки двигателя и т. Д. счетчики общего и суточного пробега.

Способы настройки приборной панели

Есть несколько способов придать приборной панели оригинальный вид. Можно изменить поверхность, покрыть кожей, покрасить, украсить специальными накладками, использовать сочетание материалов. Покрасить торпеду или обтянуть ее любыми материалами (кожа, карбон) — задача не из легких и требует извлечения детали, но конечный результат того стоит.

Прежде чем приступить к преображению поверхности, необходимо ознакомиться с паспортом автомобиля и ППД.Есть ряд материалов, которые нельзя использовать для тюнинга приборной панели (мех, обычные ткани). Краску следует брать только ту, которая предназначена для покраски автомобильных деталей. Другие виды красок могут разлагаться при повышении температуры (например, при работающей плите).

Особое внимание стоит уделить подбору цветов, если вы планируете их комбинировать. Выбирая краску для торпеды, нужно учитывать цвет крышек и даже корпуса, особенно если стекло прозрачное.Черно-белое будет хорошо сочетаться со всеми остальными. Если планируется другое сочетание, специалисты по дизайну советуют обратиться к различным таблицам сочетания цветов, которые помогут определиться с выбором.

Для обтяжки кожей или карбоном торпеда разбирается, оклеивается готовым рисунком с вырезами под детали. После подготовки поверхности можно переходить к следующему этапу. Выполнение тюнинга на панели ВАЗ 2114 не менее интересно, чем подготовка поверхности. Огромную роль в нем играет подсветка приборов, стрелок и датчиков.В идеале подсветка приборной панели должна соответствовать цветовой гамме мультимедийной системы.

Панель приборов ВАЗ 2114 можно настроить с помощью специальных накладок со стилизованным изображением спидометра и тахометра. Такие накладки позволяют изменять тонировку подсветки за счет прозрачности элементов картинки и встроенных фильтров. К таким накладкам следует обращаться с умом, так как в результате вы можете получить неравномерное освещение (яркое слева, тусклое справа) или яркости имеющихся ламп недостаточно, чтобы пробить накладку, и их придется заменены на более сильные.

На панели ВАЗ 2114 тюнинг начинается с демонтажа штатной приборной панели. Затем при необходимости лампочки меняют. Например, зелень, отгруженную с завода, можно заменить на красную. Затем устанавливается новая накладка, крепятся стрелки и защитное стекло. Новая приборная панель ВАЗ 2114 готова. Сделать своими руками панель ВАЗ 2114 под силу многим автолюбителям.

При этом опытные водители советуют не менять форму, возводя дополнительные стены пенополиуретаном или отрезая лишние детали.Объясняется это тем, что торпеда, как и приборная панель ВАЗ 2114, сделана на основе сложных расчетов, которые серьезно сказываются на безопасности водителя и пассажиров.

ВАЗ 2114 — это один из первых отечественных автомобилей, в котором применена электронная комбинация панели приборов. «Первопроходцем» в этой области была, конечно же, «дюжина», после которой электроника стала применяться на всех последующих моделях ВАЗ. А сегодняшнюю статью мы посвятим приборной панели

Устройство и характеристика

Панель приборов ВАЗ 2114, помимо электронной комбинации, отличается еще и расположением подсветки.И если на «Самаре» первого поколения она была организована снаружи, что затрудняло доступ к приборной панели при разборке, то на 14-й «Ладе» индикация освещалась лампами изнутри. Но это далеко не все особенности данной части.

На автомобилях ВАЗ 2114 включает до 19 обозначений, основным из которых, конечно же, является тахометр, спидометр, датчики охлаждающей жидкости и уровня топлива.

Датчик температуры охлаждающей жидкости

И начнем обзор обозначений слева.Здесь на приборной панели на ВАЗ 2114 есть указатель. Красная шкала начинается с 105 градусов Цельсия и заканчивается на 130. Для заметки отметим, что если указатель этого датчика находится в этом диапазоне, следует немедленно остановить двигатель и подождать пока не остынет. В противном случае закипание мотора неминуемо.

Тахометр

Далее у нас есть тахометр. Это самый большой индикатор часового типа на приборной панели после спидометра. По его обозначениям видим, что нормаль должна быть в районе от 2 до 5.5 тысяч оборотов (холостые обороты не в счет). Далее идет красная полоса. Попадание стрелки в этом диапазоне не так опасно, как с датчиком температуры охлаждающей жидкости. Однако не следует забывать, что непомерно высокая скорость вращения влечет за собой не только, но и значительную нагрузку на все остальные детали двигателя.

Спидометр

Приборная панель ВАЗ 2114 непременно оснащена спидометром. Это самая важная деталь щитка. Именно от ее показаний зависит контроль водителя за скоростью, а соответственно и безопасность.Следовательно, он должен отображать показания с максимальной точностью 0,1 километра в час. На панели приборов ВАЗ 2114 имеется шкала спидометра со значением измерения от 0 до 200 километров в час. Интересно, что почти на всех отечественных автомобилях есть спидометры, измеряющие показания свыше 170 км / ч. Например, на ГАЗелях максимальная скорость находится в районе 180-200 километров в час (в зависимости от года выпуска). Странно, конечно, что легкий фургон разгоняется до заданных значений, здесь минимум «сотку» с горы набрать…

Датчик уровня топлива

Последний индикатор часового типа измеряет уровень топлива в бензобаке автомобиля. Он расположен по стандартной схеме — в правой части приборной панели. На шкале всего 3 символа: 0, ½ и 1. Конечно, он не измеряет данные с такой же точностью, как спидометр, но узнать примерный остаток топлива вполне возможно.

Итак, мы узнали особенности, отличающие приборную панель ВАЗ 2114, и выяснили ее устройство.


При покупке нового или подержанного автомобиля владелец должен сначала понять, как управлять машиной и всеми ее системами. Для этого следует знать распиновку панели приборов на ВАЗ 2114, так как мы сегодня говорим об этой машине.

Предлагаем вашему вниманию подробное описание кнопок на панели приборов ВАЗ 2114, иконок, лампочек и других устройств и индикаторов.

Базовые устройства и их расшифровка

Конечно, наиболее значимыми устройствами на приборной панели являются:

  • Спидометр;
  • Тахометр;
  • Индикатор температуры охлаждающей жидкости;
  • Указатель уровня топлива в баке.

Рассмотрим их подробнее.

  1. Спидометр. На ВАЗ 2114 предусмотрена установка индукционного спидометра, который получает данные о скорости благодаря датчику, расположенному на коробке передач. Спидометр показывает текущую скорость автомобиля. Шкала делится от 0 до 200 километров в час с шагом 10 километров в час. Такие устройства имеют погрешность не менее 5 километров в час. Ниже центра спидометра находится дисплей с двумя линиями.Она сообщает о текущем пробеге, а вторая — об общем пробеге, совершенном на этой машине.
  2. Тахометр. Находится слева от спидометра. Тахометр — это электронное устройство, которое принимает сигналы от бортового компьютера и отражает текущую частоту вращения коленчатого вала. Шкала сделана с делением на 5 единиц. Оцифровка — каждые 10 единиц шкалы. Максимальная шкала тахометра — 80. Умножая это число на 100, получаем количество оборотов.Например, если по шкале 40, то коленчатый вал вращается на 4000 об / мин. Диапазон от 55 до 60 имеет красный оттенок, а 80 полностью окрашен в красный цвет. Это критические обороты, при достижении стрелкой которых двигатель работает при экстремальных нагрузках и может выйти из строя. Внизу тахометра, посередине отображается время и температура воздуха.
  3. Индикатор температуры охлаждающей жидкости
    За температурой охлаждающей жидкости следует постоянно следить, поэтому на приборной панели для этого предусмотрен соответствующий индикатор.Он расположен слева от тахометра, сообщает текущую температуру охлаждающей жидкости. Данные поступают с соответствующего датчика. Деление выполняется с шагом 20 градусов. Оцифровка начинается с 50, затем идет 90 и 130. Опасная зона начинается с 105 градусов. Если стрелка находится в этой зоне, двигатель необходимо немедленно остановить, иначе произойдет перегрев и поломка.
  4. Указатель уровня топлива
    Он расположен справа от спидометра. На шкале нанесены цифры и изображения, означающие:

    1. 0 — бак пуст;
    2. 1/2 — бак наполовину заполнен;
    3. бак полный;
    4. Изображение АЗС вверху — бак заполнен до предела;
    5. Изображение заправочной станции справа внизу с оранжевой подсветкой — в баке осталось менее 6 литров топлива.

Лампочки, значки индикаторов.

Имея перед собой фото значков, разобраться с их обозначением на панели приборов ВАЗ 2114 будет намного проще.

Иконки выполнены в строгом соответствии с нормами и требованиями, что позволяет понять их назначение вне зависимости от модели, производителя. Все автомобильные компании должны унифицировать обозначения. Это позволяет понять их суть каждому водителю.

На ВАЗ 2114 с новейшим инжекторным двигателем обозначения расположены внизу панели приборов.Предлагаем соответствующую таблицу с расшифровками.

Изображение Обозначение
Значок канистры с каплей жидкости Изображение сообщает о снижении уровня масла в картере двигателя ниже допустимого уровня, выделено красным цветом
Икона дворников и фонтан Сообщает о недостаточном количестве омывающей жидкости. Если осталось меньше литра, значок загорится оранжевым цветом
Значок термометра Указывает на снижение уровня охлаждающей жидкости в расширительном бачке на холодном двигателе ниже допустимого уровня.Горит оранжевым цветом
Значок открытой двери автомобиля Сообщает, что некоторые двери не закрыты. Выделено красным цветом
Значок перечеркнутой лампочки Сообщает о неисправности габаритов или стоп-сигналов
Значок в виде круга с обводками по бокам. Переговоры о неисправностях тормозов, тормозных колодок
Icon человек с ремнями безопасности Сообщает, что кто-то не пристегнул ремни безопасности.
Значок с двумя зелеными стрелками Сигнал включения левого или правого указателя поворота
Значок проверки двигателя Горит красным при неисправности двигателя
Значок синей лампочки Речь о дальнем свете на
Значок зеленой лампочки Говорит о включении ближнего света.
Обозначения, имеющиеся на ВАЗ 2114 более ранних версий
Красный значок канистры с каплей жидкости Сигнализирует о падении масла, означает аварийное давление масла
Буква «П» в круге Сигнализирует, что ручной тормоз не задействован
Изображение батареи Загорается при низком заряде аккумулятора

Значок восклицательного знака в круге

Горит красным, указывает на снижение уровня тормозной жидкости.

Кнопки и их обозначение

Теперь перейдем непосредственно к кнопкам, которые также занимают достойное место на приборной панели ВАЗ 2114.

  1. Кнопка в правом нижнем углу спидометра позволяет переключать температуру и время на цифровом дисплее. Если удерживать ее в течение 5 секунд на неподвижном автомобиле, текущие данные о пробеге будут сброшены.
  2. Двойная кнопка с двумя переключателями. Кнопка с двумя фарами включает габариты, а кнопка с одной фарой включает ближний свет.
  3. Кнопка с наклонными штрихами и фара включает передние противотуманные фары.
  4. Кнопка с горизонтальными штрихами включает задние противотуманные фары.
  5. Кнопка с прямоугольником включает заднее стекло.

На самом деле разобраться во всех кнопках, индикаторах и указателях несложно. Наше описание кнопок на панели приборов ВАЗ 2114 позволит нам в этом разобраться. Но лучше сесть в машину с инструкциями и убедиться, что все ясно.

Никогда не игнорируйте сообщения на приборной панели. Если вы своевременно отреагируете на сигнал о пустом баке, например, вы сможете вовремя повернуть на дозаправку и не заглохнуть посреди дороги.

На ВАЗ 2114 не работает правый указатель поворота. Что делать, если перестали работать аварийка и поворотники

При ситуации, когда не работают поворотники и аварии ВАЗ 2110 или другие модели, есть немалая часть владельцев Ваз, и часто проблема их удивляет.Самая частая причина, по которой не работают поворотники на ВАЗ 2109, это то, что автоэлектрика вышла из строя.

Кстати, большинство ваз оснащено аналогичными электроходами, которые ремонтируются одинаково, поэтому советы актуальны как для модели 2109, так и для других моделей ВАЗ.

Схема включения указателей поворота и сигнализации

Причины поломки

Во избежание ситуации, когда не работают поворотные и аварийные фонари, определите причину, по которой они вышли из строя. К наиболее частым факторам поломки электрики в автомобиле относятся:

  • разгерметизация. Это вызывает попадание воды и грязи в электрика;
  • окисление. Это происходит на клеммах и приводит к потере контакта. Смотри просто: при выключении, и когда ты разбираешь оптику, ты увидишь зеленый цвет. Чтобы удалить его, рассмотрите его с помощью ветеринара и попробуйте запитать контакт;
  • Пробой предохранителя

  • . Чтобы не попасть в ситуацию, когда перестало работать аварийное освещение, найдите предохранитель, отвечающий за повороты (например, К2).Далее вам нужно будет просто заменить его. Помимо выхода из строя предохранителя, можно столкнуться с проблемой замены его контактов;

Монтажный блок предохранителей ВАЗ 2109 2108 21099

  • лампочка. Если по этой причине возник недостаток света, просто замените лампу на новую;
  • выключатель или кнопки поломки. Если не работают поворотники и ДТП, доберитесь до бачка к переключателю, находящемуся у руля, и разберите его. Вы можете просто заменить кнопку;
  • перерезал проводку.

Как исправить

При неработающих поворотниках и авариях электрик в машине чаще всего «виноват» реле, отвечающее за подачу напряжения.

Чтобы предотвратить возникновение проблемы в будущем, выполните следующие действия:

  • узнать где реле. Схема его размещения указана в прилагаемой к автомобилю инструкции;
  • давай стучим по реле. Часто причина кроется в банальном «прилипании», и удар ворона возобновляет работу оптики;
  • , если меры не помогли, и у вас по-прежнему не работают осветительные приборы, замените реле, потому что изделие недорогое.

Если на ВАЗ 2109 не работают поворотники, то езда на автомобиле должна быть прекращена. Потому что другие водители не увидят, куда бы вы ни повернули, и возникнет аварийно опасная ситуация. Страшно еще и то, что многие не сразу замечают, что не работают поворотники и продолжают ездить с неработающими поворотниками. То, что на ВАЗ 2109 не работают поворотники, разобраться очень просто, включите указатель поворота и посмотрите указатель поворота на панели приборов.

Лампочка на панели приборов должна мигать. При этом, если двигатель не запускается, вы услышите щелчки — щелкает роторы.
Если лампочка на панели приборов не мигает, а горит, значит, не работают повороты.
Причин неработающих поворотников на ВАЗ 2109 несколько:
1) Неисправность Rota Relay
2) Горящая лампочка
1) При неисправных реле поворота лампочка на панели приборов горит зеленым цветом, не мигая. Однако это не означает, что ваши поворотные реле неисправны.

Вполне может быть плохой контакт между поворотными реле и посадочным гнездом реле в монтажном блоке. Это просто включает вращение и перемещает реле поворота.

Если был плохой контакт, то в определенный момент при перемещении реле вы услышите щелчки, то есть появление нормального контакта. Узел крепления ВАЗ 2109 находится в не очень удачном месте и это постоянно

то заливается водой, то засыпает снегом и льдом.Поэтому плохой контакт реле в монтажном узле для ВАЗ 2109 — обычное дело.

2) При любом повороте указатель на панели приборов будет мигать, как будто все в порядке. В этом случае размытый свет обнаруживается только при визуальном осмотре автомобиля. Это очень легко делают владельцы ВАЗ 2109 с сигнализацией. Всегда, когда водитель выходит из машины. Включается сигнализация и машина моргает всеми оборотами пару секунд. Приехал водитель, выключил сигнализацию ВАЗ 2109, машина снова перекрыла повороты.Часто бывает, что не поборол лампочку, а просто плохой контакт лампочки с патроном фары.
В этом случае нужно просто постучать по пятнистому кулаку, может появиться контакт.

Поворотные фары должны быть в рабочем состоянии в любой машине. Этот тип оптики позволяет узнавать других участников дорожного движения о ваших намерениях при столкновении с молотком, поэтому на эффективность поворотов во многом влияет безопасность. Что если не и ВАЗ 2114 Авиан, как определить проблему и заменить лампы? Об этом читайте ниже.

[Скрыть]

Возможные неисправности: особенности и причины

Если не умеете, ничего сложного в этом нет — нужно просто замкнуть контакты, но сейчас не об этом.

По каким функциям можно выявить проблемы поворотных фонарей (ПО):

  1. Включается включается, но не работает. Неисправность такой схемы может быть вызвана сбоями в работе реле.
  2. Не работает световой сигнал.При такой проблеме на приборной панели автомобиля указатель поворота будет гореть чаще обычного.
  3. Сигнал срабатывает, но не отключается. Суть проблемы заключается в устранении неисправностей в работе переключателя, расположенного за рулем автомобиля.
  4. Источник освещения в оптике мигает чаще обычного. Судя по всему, одна из ламп, установленных по углам, была издана. Проблема также может быть в окислении контактов, в частности, речь идет о самих фонарях или контактах в блоке с элементами безопасности.
  5. Лампы по очереди горят, но гораздо тускло, чем всегда. На практике такая проблема обычно появляется после установки в фары нестандартных осветительных приборов (ламп). Проблема в контактах.
  6. При включении реле громко щелкает. Причину следует искать в плохих или поврежденных контактах на колодке, возможно выход из строя самого реле.
  7. Часто неисправность храброго предохранителя кроется. Это приводит к закрытию ПО, и часто такая проблема проявляется в задней оптике.Это место специалисты называют «болезнью» не только модели 2114, но и другие вазоны. Излишне окисляются контакты, что приводит к образованию коррозии и замыканию (на видео снял Владислав Чиков).

Как проверить осветительные приборы в «четверке»?

Процедура проверки следующая:

  1. Для начала нужно убедиться, что у вас исправный предохранитель. Блок предохранителей находится в отсеке бювета, в отсеке между двигателем и лобовым стеклом, напротив сиденья водителя.Отогните защелку и снимите крышку, после чего внимательно осмотрите ее внутреннюю часть. Вызывает схему, которая поможет разобраться, какой предохранитель отвечает за работу того или иного оборудования.
    Извлеките предохранитель, отвечающий за работоспособность ПО, и внимательно его осмотрите — если внутри переплавляется резьба или она повреждена, предохранитель подлежит замене. Но даже при отсутствии видимых повреждений необходимо вставить в гнездо извлеченного взрывателя еще один с соответствующим номиналом.
  2. Если не помогло восстановить работу ПО, то проверьте реле, оно находится в том же блоке. Как правило, на реле роторов есть значок, его нужно вытащить и заменить рабочие. Для этого необязательно покупать новое реле, нужно вытащить другое работающее устройство и установить его. Если отделения неотложной помощи так и не работают, то продолжайте проверку.
  3. Сейчас необходимо провести диагностику лампочек, но эта проверка требуется, если не работает только часть витков.Откройте капот или багажник и снимите фары, после чего уберите источники света с сидений. Установите рабочий прибор вместо извлеченной лампы и проверьте, как он работает. При отсутствии изменений идем дальше.
  4. Нужно проверить целостность электрических цоколей. Для этого вам понадобится контрольная лампа с подключенными к ней двумя проводами. Один конец нужно подключить к минусу аккумулятора или корпуса «четверки», а второй провод подключить к контакту диагностируемого электрочайника.
    Если в результате подключения лампа начала гореть, это свидетельствует о рабочем месте токопроводящего провода. Аналогично проверяются остальные цепочки. Если вы найдете место, где нет тока, это указывает на наличие неисправности между проверяемым местом и последней точкой, где было напряжение. Поврежденные провода подлежат замене.
  5. Также нужно проверить качество контактов на всех электрических цоколях. Проверить контакты в монтажном блоке, на основании в оптике автомобиля, на кнопке световой сигнализации и переключателе на рулевом колесе.Часто причиной проблем является именно окисление, такие контакты подлежат чистке или замене.

Фотогалерея «Неисправности поворотов»

Инструкция по ремонту и замене указателей поворота и аварийной сигнализации своими руками

Перед снятием и заменой вышедших из строя осветительных приборов на белые или желтые, необходимо выключить зажигание и аккумулятор. Это позволит избежать закрытия. Работы по замене следует проводить в перчатках, чтобы не испачкать стеклянные лампочки.

Как поменять лампы в:

  1. Для начала нужно отсоединить разъем от оптики с подключенными проводами.
  2. Затем кончик пружины отпускается.
  3. Теперь нажмите на крепление, расположенное между оптикой, и поверните. Снимите блок с источника света с места посадки.
  4. Лампочки заменены нерабочие, сборка производится в обратной последовательности.
  5. Что касается репитера, то он снимет свой корпус с места посадки вместе с прорезиненной прокладкой примерно на полсантиметра вперед.
  6. Отображение задней части устройства с места установки.
  7. Полностью снимите повторитель, затем отсоедините вилку с проводкой и снимите прокладку. Саму прокладку необходимо установить на новый репитер.
  8. Теперь осталось соединить вилку с проводкой и установить репитер обратно.

Видео «Габариты в поворотники своими руками»

Если вы хотите сделать так, чтобы общий свет горел в углах автомобиля, то вам поможет в реализации этой идеи видео с подробная инструкция по выполнению этой задачи (видео опубликовано на канале Александра Янтаря Коломенского ААЦ).

Не работать могут быть как один знак поворота («повороты»), так и два, или все сразу и т.д., в разных сочетаниях.

Рассмотрим причины данной неисправности на автомобилях ВАЗ 2108, 21081, 21083, 2109, 21091, 21093, 21099.

Причины неисправности указателей поворота

1. Не работает один указатель поворота (передний или задний).

Перегорающая лампочка

При включении одного или нескольких указателей поворота на ВАЗ 2108, 2109, 21099 лампочка может мигать с двойной частотой.Устанавливаем визуально там, где перегорела фара, в свою очередь включаем указатели поворота. Заменяем лампочку.

Окисленная патронная лампа

Несколько раз поверните лампочку в патроне, чтобы восстановить контакт.

Окисленные или ослабленные соединения проводов

Проверяем патроны и колодки передних поворотников (в фарах переднего блока и на крыльях) и соединительные блоки задних фонарей автомобиля.

«Горожане» указателя поворота на крыле автомобиля ВАЗ 2108 (2109, 21099)

Исчезла

Все лампы и фонари автомобилей ВАЗ 2108, 2109, 21099 имеют отрицательный провод, поэтому его следует проверять «массовым» контактом.

Заблокирована колея в задних фонарях задних

Указатель поворота в передней блок-фаре автомобилей ВАЗ 2108, 2109, 21099

2. Не работают два задних повторителя или два передних.

Четыре первые причины

Перегорели

лампочки, окислились их патроны, окислились контакты в соединительных колодках указателей поворота (на блоке фар и «поворотниках» на крыльях), пропала масса.

Обрыв в проводах, идущих от монтажного блока к задним фонарям

— В некоторых случаях одновременно могут гореть все указатели поворота, при этом постоянный свет не мигает. В этом случае необходимо заменить реле указателя поворота в монтажном блоке.

В Интернете очень часто забивают такие просьбы от новичков: «Почему не включаются поворотники?» — У нас есть ответ на этот вопрос. Сегодня мы рассмотрим основные неисправности, из-за которых не работают поворотники на вашей машине.

Часто ремонт поворотников очень прост, главное найти истинную причину неисправности. В первую очередь рекомендую посмотреть видео, где рассказывают, как определить неисправность.

Видео. Не работают поворотники

Напомним, что в предыдущей статье мы рассматривали сделай сам. Выполнить эту операцию можно в гаражных условиях, не забудьте подготовить большое количество тосола или тосола.

Основные неисправности токарной обработки

Не мигают указатели поворота

Когда на ваших машинах перестали мигать поворотники, скорее всего, причина кроется в реле поворотного механизма.Причиной неисправности может быть простая вода, которая ее залила или где-то прерывается контакт. Рекомендуем заменить.

Пусковой ток ВАЗ 2114. Какой аккумулятор выбрать для ВАЗ


Автомобильный аккумулятор предназначен для запуска двигателя и в качестве резервного источника питания для основных потребителей в случае, если генератор не работает или двигатель не работает. Кроме того, при включенном двигателе аккумулятор помогает генератору в переходных режимах или при сглаживании пульсаций напряжения.

Типы аккумуляторов, применяемых в автомобилях ВАЗ

Чтобы выбрать подходящий аккумулятор для автомобиля, вам необходимо знать некоторые особенности его устройства и условия, при которых они сохраняют достаточную производительность.

Все свинцовые автомобили теперь оснащены свинцово-кислотными аккумуляторами. Стандартная батарея этого типа состоит из шести батареек, соединенных вместе в пластиковом корпусе, не пропускающем ток. Электроды из свинцовых сплавов имеют решетчатую структуру. Их погружают в электролит из раствора серной кислоты.На верхней панели есть отверстия для отвода газа во время зарядки. Подключает аккумулятор, установленный на машине, к двум свинцовым проводам, размещенным на этой панели. Для удобства использования «положительный» вывод толще, чем «отрицательный».

Электролит чувствителен к температуре. Оптимальным для наиболее эффективной работы аккумулятора является — плюс 27 градусов. В то же время снижение температуры воздуха до минус восемнадцати градусов приводит к падению до 50 процентов емкости аккумулятора.В физическом смысле это означает, что для запуска машины требуется в два раза больше энергии. Кроме того, нужно помнить, что при серьезном отрицательном значении температуры подзарядка практически не производится. Аккумулятор работает на износ. При высоких температурах часто имеет место так называемый «горячий старт». Двигатель с горячим запуском требует значительно большей мощности.

Таким образом, выбирая, какой аккумулятор на ВАЗ 2114 нужно покупать, необходимо учитывать емкость аккумулятора, номинальную мощность потребителей энергии, особенно при пуске, а также страну производителя. .Последнее условие связано с тем, что желательно, чтобы в этой стране температурный режим был похож на российский.

Специалисты рекомендуют определять емкость приобретаемого аккумулятора по формуле — (максимальный ток генератора обратной связи в Ач) х 0,75. То есть, если на ВАЗ 2114 установлен генератор на 80 Ач, аккумулятор для этой машины обязательно должен иметь емкость 60 Ач.

При этом АКБ не стоит ставить намного емкостнее, так как мощности генератора может не хватить для подзарядки.

Выбирая акб на ВАЗ 2114, необходимо обратить внимание на следующие основные параметры АКБ: размер, емкость, полярность, тип и страна производителя, год выпуска.

  1. Один из важнейших показателей, определяющих, какой аккумулятор на ВАЗ 2114 выбрать, — это размер приобретаемого аккумулятора. Это важно, потому что место в моторном отсеке для этого агрегата специально оборудовано. Провода для подключения имеют строго определенную длину.Любая батарея нестандартного размера либо не войдет в место установки, либо будет болтаться, так как закрепить ее не удастся. Стандартный размер ВАЗ 2114 — 242х175х190 мм.
  2. Мощность также должна соответствовать требуемым параметрам для нормального пуска двигателя в любых погодных и температурных условиях. Завод-производитель устанавливает на ВАЗ 2114 аккумулятор емкостью 55 Ач. Специалисты рекомендуют приобретать аккумулятор емкостью 60 Ач. Автоэлектрики считают такие аккумуляторы наиболее оптимальными для автомобилей ВАЗ.
  3. Для автомобилей европейского и американского производства подбираются аккумуляторы с обратной полярностью.
  4. Особое внимание при выборе акб на ВАЗ 2114 стоит обратить на год выпуска АКБ. Любая батарея, срок хранения которой превышает один год с даты выпуска, в обязательном порядке должна пройти процедуру подзарядки.
  5. Батареи продаются в двух состояниях: залитые электролитом и заряженные до необходимой емкости, а также сухозаряженные. После покупки аналогичного аккумулятора его необходимо залить кислотой плотностью 1.25 г / куб. и выше. Эту плотность следует измерять при температуре воздуха плюс 25 градусов. Через двадцать минут после того, как заправили аккумулятор, необходимо проверить натяжение банок без нагрузки. Нормальные рабочие показания составляют 12,5 В или более. Если напряжение меньше 12,5 В, аккумулятор требует дополнительной зарядки. Если показания равны 10,5 В или меньше этого значения, то это заводской брак и применять такой агрегат отнюдь не возможно.

Если автовладелец собирается покупать аккумулятор на ВАЗ 2114, то он должен посмотреть, в какой стране производитель аккумуляторов и какой марки предлагается.На форумах и некоторых ресурсах в Интернете приведены результаты опросов драйверов с рекомендациями производителей аккумуляторов:

  • безусловным лидером такого опроса является аккумуляторная батарея под брендом «Тюмень» производства Тюменского аккумуляторного завода. Для ВАЗ 2114 подходят два типа аккумуляторов этой марки — 6СТ-57 и 6СТ-60. Их емкость составляет 57 Ач и 60 Ач соответственно. Температурный диапазон от минус сорока до плюс шестидесяти градусов. Эти аккумуляторы обладают хорошей скоростью приема заряда и высоким разрядным током, что обеспечивает стабильный запуск двигателя в любых условиях;
  • Следующим в рейтинге идет АКБ под брендом «Зверь».Производитель — «Аккумуляторные технологии» со штаб-квартирой в Иркутской области. Подходит для аккумуляторов ВАЗ емкостью 55, 60, 66 и 70 Ач. Эти аккумуляторы имеют хорошую гарантию три года;
  • Аккумуляторные батареи

  • «Варта» пользуются большой популярностью. Разработчик этого продукта, американская компания «Johnson Controls», обеспечила высокую производительность этой батареи при эксплуатации. Гарантийный срок на нее также составляет три года. На практике многие водители эксплуатируют его по четыре года;
  • многие автолюбители рекомендуют аккумулятор «Бош» ёмкостью 70 Ач.В первую очередь из-за их высокой надежности, которая позволяет эксплуатировать этот аккумулятор в течение пяти лет. Ток холодного старта 500 А, это высокий показатель, позволяющий безопасно эксплуатировать данную батарею в условиях низких температур.

Когда водитель сталкивается с проблемой выбора аккумулятора, он смотрит не в последнюю очередь, а сколько стоит аккумулятор на ВАЗ 2114. Конечно, идеальный вариант — это когда оптимальное соотношение «цена — емкость — надежность».

Тем не менее, опытные водители и специалисты по ремонту рекомендуют не экономить на таком важном агрегате, как аккумулятор.Мощный и надежный аккумулятор — это стабильный запуск при минимальной температуре.

Всем привет, пока идут жаркие дискуссии о новом DRIVE2, закипании говна и т.д. Я
сегодня наконец-то перешился на зимний (сугробы полметра).
Спасибо нашим любезным сотрудникам вне отдела за то, что они вытолкнули мою машину во двор, и другу, который бросил меня перед замерзшими руками. Продолжаю второй год безответственной езды без балонника и домкрата.

О корпусе:
Вспоминая прошлую зиму (недобрым словом) хочу купить себе новый аккум, т.к. Были случаи, когда у меня не заводилась и в -15-20 (я уж не про -38).
Главный критерий — подержать и покрутить стартер на морозе.
Я понимаю, что у всех разный опыт использования и даже на одну и ту же модель отзывы могут отличаться, но все же посоветуйте на свой взгляд и испытайте супернажный аккумулятор для автомобиля.

Не знаю точно, что можно выставить при максимальной мощности и токе прокрутки, есть ли разница, что у меня движок приор или он такой же? У меня вот такой — АККУМ 55/460 СТАНДАРТ

Вроде приору изначально ставится с завода по мощнее, но от мотора это зависит?
Заранее спасибо за совет!

ОБНОВЛЕНО 20 МАРТА 2014 ГОДА.
Брал себе Titan Arctic Silver 62.

по отзывам в интернете и соотношение цена качество исходя из их выбора упало именно на эту батарею, есть индикатор зарядки и ручка

еще не доставил в машина, только лифт

фото с сайта, где заказал

ОБНОВЛЕНО 15 ДЕКАБРЯ 2015.

Ребята, катаюсь уже больше года, очень нравится много, напряжений нет, той зимой я начал влетать в минус 25, всем рекомендую такой объем и такой пусковой ток.Были сомнения, что может быть много — в самый раз.
Единственное — у кого в настройках сигнала автозапуск на зиму стоит увеличить скорость прокрутки стартера до 1,2-1,5 сек для схватывания. Сам аккум пока без проблем.

Как выбрать аккумуляторы для автомобилей ВАЗ? Несмотря на обилие иномарок, наибольшее количество автомобилей в России представлено маркой Lada (LADA) производства ВАЗ. Поскольку существует множество различных моделей и модификаций, владельцев волнует вопрос: какую марку и по параметрам аккумулятор можно считать оптимальным для конкретной машины? Итак, выбираем аккумулятор на ВАЗ.

Общие правила выбора аккумуляторов для автомобилей ВАЗ

1.
Обязательно укажите ключевые параметры. К ним относятся емкость , полярность, тип клеммы и — размер батареи .
2.
Указанная емкость на приобретенном аккумуляторе должна совпадать по величине с имеющейся или незначительно отличаться от нее. Это влияет на электрооборудование каждого автомобиля. 3.
Проверьте размер батареи. Аккумулятор на ВАЗе, как правило, имеет показатели 242х175х190 мм .Это стандартные габаритные размеры для всех моделей ВАЗ. Однако лучше подстраховаться, а аккумулятор померить. 4.
Следующий пункт — определение индикатора полярности. С этим сложностей возникнуть не должно, так как практически все модели ВАЗ отличаются прямой полярностью. 5.
При определении типа клемм необходимо знать следующее. Для моделей ВАЗ оптимальны аккумуляторы с европейскими клеммами, которые в отличие от азиатских более объемны.А от американских они отличаются отсутствием резьбы. 6.
Перед покупкой аккумулятора стоит учесть условия, в которых будет эксплуатироваться автомобиль. Если машина будет ехать на морозе, специалисты советуют выбирать аккумулятор с запасом емкости, скажем, на 5-10 Ач больше стандартного. Еще один момент в выборе связан с особенностями езды по бездорожью. В этом случае лучше выбрать аккумулятор с дополнительной фиксацией пластин.

Особенности выбора аккумулятора для определенных моделей ВАЗ

ВАЗ 2105, 2106, 2107. Стоит учитывать, какой тип двигателя установлен — инжекторный или карбюраторный. Для автомобилей с карбюраторным двигателем менее 1,2 л подходит аккумулятор на 44 Ач, до 1,8 л — 55 Ач, свыше — 62-66 Ач. Если есть инжекторный двигатель объемом менее 1,6 л, нужен аккумулятор на 44 Ач, от 1,6 до 2,5 л — уже на 55 Ач. ВАЗ 2109. Стоит выбирать в зависимости от климата. Для местности с умеренным морозом оптимально подойдет свинцово-кислотный аккумулятор, а в более теплом климате стоит выбрать необслуживаемый аккумулятор. ВАЗ 2110, 2111 и 2112. Заводское оборудование комплектуется свинцово-кислотным аккумулятором с жидким электролитом емкостью 55 Ач, он считается наиболее оптимальным для электросистемы данных моделей. Эта батарея классифицируется как необслуживаемая. И при замене необходимо учитывать наличие установленного на машине дополнительного оборудования. Чем он больше, тем мощнее аккумулятор. ВАЗ 2114, 2115. Подходит аккумулятор на 55 — 62 Ач. Если вы выбираете между классическим аккумулятором и необслуживаемым аккумулятором, больше водителей предпочитают второй вариант. Приора, Лада Ларгус. У Приоры в заводской сборке стоит аккумулятор на 55 Ач. Но на Лада Ларгус стоит аккумулятор с обратной полярностью. Без присмотра, показатель емкости 70 Ач.

Рекомендации по выбору аккумулятора от «First Battery Company»

Мы рекомендуем аккумуляторы следующих марок: AUTOPART, ECOSTART, JP DYNAMIC и 1STORM. Эти марки представлены АКБ европейского производства. В них реализованы современные технические решения. Эти аккумуляторы обладают хорошей пусковой мощностью, минимальным саморазрядом, повышенной безопасностью.Они отлично подходят для нашего климата — благодаря повышенной морозостойкости. Важно, чтобы данные аккумулятора зарекомендовали себя в различных ситуациях.

Типы автомобильных аккумуляторов?

Устройство свинцово-кислотных аккумуляторов

Самый распространенный тип аккумуляторов — свинцово-кислотные. В таких батареях обычный электролит представляет собой смесь дистиллированной воды и серной кислоты.

Аккумуляторная батарея AGM

Аккумулятор другого типа построен на основе технологии AGM (Absorbent Glass Mat).В них электролит абсорбируется стекловолокном.

Устройство гелевой (не обслуживаемой) батареи

Аккумулятор третьего типа называется гелевым. Технология называется GEL, в гелевых батареях электролит загустевает до гелеобразного состояния с силикагелем. Не проверяют уровень жидкости — это , не обслуживаемый . У них очень высокий уровень электролита над пластинами и запас плотности. Один запуск двигателя забирает у аккумулятора столько же энергии, сколько он получает от генератора за 10-15 минут при нормальной скорости.Зимой расход больше. Аккумулятор не может быть полностью заряжен, если ежедневные поездки короткие. Генератор не успевает полностью зарядить аккумулятор, поэтому иногда рекомендуется зарядить аккумулятор от зарядного устройства в домашних условиях. Летом необходимо проверять уровень электролита, так как из-за жары вода испаряется. Она испаряется даже на стоящей машине. При необходимости (если конструкция позволяет) долить дистиллированную воду (и только воду).

Как выбрать емкость аккумулятора?

Штатный аккумулятор ВАЗ 2110 имеет емкость 55 Ач.Допускается выбрать мощность чуть выше паспортной, что позволит немного лучше заводиться зимой. Разница в 55Ач и 60Ач незначительна, но аккумулятор на 55Ач зарядится полностью быстрее.

Как продлить срок службы батареи?

Срок службы батареи зависит от модели и сервиса и может сильно варьироваться (от 1 до 9 лет). Считается, что 4 года жизни — это разумный минимум. Оптимальная температура хранения аккумулятора 0 градусов. При этом замедляется процесс саморазряда и электролит ломает корпус даже при его полном разряде.Регулярно проверяйте уровень электролита. При необходимости продолжайте в том же духе и не забудьте зарядить аккумулятор. Не разряжайте аккумулятор полностью. Если аккумулятор хотя бы один раз полностью разрядится, это значительно сократит срок его службы. Во избежание проблем с запуском двигателя зимой необходимо поддерживать заряженный аккумулятор, а также следить за плотностью электролита. Плотность электролита полностью заряженной батареи 1,27 при 20 C увеличивается на 0,007 на каждые 10 градусов.ниже 20. То есть. плотность электролита нормально заряженного аккумулятора при -20 градусах будет 1,3. На зиму плотность электролита следует увеличить до 1,29. Так же и для высоких температур, при +40 С окружающего воздуха 1,25 — это нормально, аккумулятор полностью заряжен.

Как определить состояние аккума?

Если в одной из банок АКБ по сравнению с остальными упала плотность, а уровень остался прежним — идет процесс сульфатации, а это начало гибели аккумулятора (мутный электролит).Плохая банка не только ток не дает, но и высасывает его из соседних, т.е. оставив без проблем днем, можно утром в теплую погоду машину и не запускать … В домашних (гаражных) условиях, сделать практически невозможно, пора искать замену.

Почему батарея быстро разряжается?

Если аккумулятор быстро садится, значит, ежедневного пробега генератору не хватает для полной зарядки аккумулятора. Либо есть ток утечки АКБ. Если нет желания обслуживать аккумулятор, то рекомендуется выбрать гелевый аккумулятор.Если автомобиль с заглушенным двигателем долго не слушает музыку при включенном свете и нет утечки тока, то он прослужит минимум 4 года и зимой не выйдет из строя. Перед покупкой ознакомьтесь с последними отзывами и тестами аккумулятора. Покупая аккумулятор, обращайте внимание на то, чтобы он был свежим. Если он заправлен и заряжен, то до 3 месяцев после изготовления, а если сухой, то до 6 месяцев. Цена на аккумулятор зависит от его типа, марки и емкости (средняя цена 2500-4000 рублей).Купить аккумулятор можно в интернет-магазинах.

Аккумулятор играет огромную роль в работе автомобиля. На самом деле без него нельзя запустить двигатель, потому что стартер питается от аккумулятора.

Следовательно, если старый аккумулятор начинает работать с перебоями, с ним регулярно возникают проблемы, его необходимо заменить. Но какой аккумулятор выбрать на ВАЗ 2114? Сегодня мы поговорим об этом.

Что используется для автомобилей ВАЗ?

Чтобы понять, какой аккумулятор выбрать, для начала нужно разобраться в устройстве и принципах работы аккумулятора.

На автомобили отечественного производства АвтоВАЗ установлено свинцово-кислотных аппаратов.
.

В стандартную версию этого аккумулятора входят шесть аккумуляторов, которые объединены в одну упаковку. Корпус сделан из специального пластика, который не проводит ток. Электроды со свинцовым сплавом имеют решетчатую структуру. Их погружают в электролит, состоящий из раствора серной кислоты.

Сверху на панели расположены отверстия для слива газов при зарядке АКБ.Аккумулятор подключается к автомобилю с помощью двух выводных клемм, которые также расположены на панели. Чтобы водителю было проще сломать выводы, положительный толще, а отрицательный тоньше.

Важно учитывать тот факт, что температура окружающей среды влияет на электролиты. Лучшая батарея при температуре +27 градусов Цельсия. Если температура воздуха опускается до -18 градусов по Цельсию, емкость аккумулятора снижается на 50%. Это говорит о том, что для запуска мотора потребуется вдвое больше энергии.

Водители

должны помнить, что их нельзя заряжать при серьезных отрицательных температурах, потому что тогда аккумулятор будет работать на пределе своих возможностей.

Нагрев у вашего аккумулятора тоже не тот, так как происходит горячий запуск. Если двигатель сильно нагрелся, ему также потребуется большое количество электроэнергии, а также при очень низких температурах.

На что обращать внимание при выборе

При покупке нового аккумулятора нужно учитывать следующие аспекты:

  • Емкость аккумулятора;
  • Номинальная потребляемая мощность;
  • Страна производитель АКБ.

Что касается емкости, то для этого разработана довольно простая и эффективная формула. Он включает в себя увеличение тока перегрузки на выходе генератора на 0,75. Если, например, у вас есть генераторная установка на 70 Ач, емкость аккумулятора должна быть 52,5 Ач. Ближайший по емкости аккумулятор — 55 Ач.

Также многое зависит от объема двигателя. Для автомобилей с моторами 1,0–2,3 л следует использовать аккумуляторные батареи от 55 до 66 Ач.

Не рекомендуется выбирать аккумулятор большой емкости, поскольку для его подзарядки может банально не хватать мощности вашего генератора.

  1. Размер. В подкапотном пространстве ВАЗ 2114 есть отведенная площадка для установки АКБ, плюс провода для подключения ограничены по длине. Если аккумулятор нестандартного размера, он не поместится в место для установки или будет беспрепятственно «гулять» по нему. Исправить никак нельзя. Поэтому учтите стандартное сиденье аккумулятора для «четырнадцатой» модели — 242 на 175 на 190 миллиметров.
  2. Вместимость. С этим параметром мы уже разобрались и определили, что для нормального пуска силового агрегата в разных климатических условиях подойдет агрегат на 55Ач.Хотя специалисты советуют устанавливать устройство на 60 Ач. Посоветовавшись с электриками стало очевидно, что для ВАЗ 2114 оптимальным параметром является ровно 60 Ач.
  3. Полярность. Европейские и американские производители используют аккумуляторные батареи с обратной полярностью. Прямая полярность отличается тем, что «плюс» находится слева, а «минус» — справа. Японские и корейские автопроизводители предпочитают прямую полярность.
  4. Год выпуска. Обратите внимание, когда разрядился аккумулятор.Если он был изготовлен более года назад, то аккумулятор следует перезарядить. Аккумуляторы нельзя хранить без подзарядки более года.
  5. Зарядка. Некоторые аккумуляторы можно заряжать электролитом и заряжать до необходимых параметров, другие называются сухозаряженными. Покупая аккумуляторы второго типа, их необходимо залить кислотой. Плотность раствора от 1,25 г / куб. Плотность измеряется при температуре +25 градусов Цельсия. После заправки АКБ обязательно постоять минут 20, а затем проверить напряжение, но только без нагрузки.Оптимальная производительность составляет от 12,5 В и более. Если напряжение меньше, аккумулятор придется перезарядить. Если прибор показал около 10,5 В и меньше, значит, вам «посчастливилось» купить аккумулятор с заводской неисправностью. Нет необходимости использовать его в автомобиле ни при каких обстоятельствах. Меры по подзарядке не помогут.

Производителей

По поводу производителей аккумуляторов, подходящих к автомобилю ВАЗ 2114, хочу поговорить отдельно.На основе анализа рынка, изучения отзывов потребителей сформировалась определенная группа лидеров. Мы познакомим вас с ней.

  1. Лидером аккумуляторного сегмента, в ассортименте которого есть агрегаты, подходящие для ВАЗ 2114, стала марка «Тюмень». Производитель — аккумуляторный завод в Тюмени, о чем вы, наверное, догадались. Среди их ассортимента для ВАЗ 2114 подходят модели 6СТ 57 и 6СТ 60. Соответственно их емкость 57 и 60 Ач. Они способны работать в диапазоне температур от -40 до +60 градусов Цельсия.Хорошая и быстро заряжается, дает эффективный ток, гарантирует качественный запуск двигателя независимо от погоды.
  2. Вторую строчку по праву заняли батареи «Зверь». Это продукция компании Accumulator Technology. Их головной офис находится в Иркутской области. Для «четырнадцатой» модели ВАЗ рекомендуется использовать аккумулятор емкостью от 55 до 70 Ач. Производитель предоставляет гарантию сроком на 3 года, которая есть не у каждой компании.
  3. «Варта» — еще один лидер среди производителей аккумуляторов, которые отлично вписываются в моторный отсек ВАЗ 2114. Это уже иностранный производитель — США. Компания-разработчик называется Johnson Controls. Аккумуляторы отличаются высоким КПД и надежной работой. Гарантийный срок тоже впечатляет — три года, хотя по факту батарея служит 4 года и более.
  4. В списке лидеров не обошлось без Bosch. Иногда кажется, что эта фирма слишком много берет на себя и производит буквально все для всех.Но пока компания этим занимается, заказчики довольны этим фактом. Здесь стоит обратить внимание на аккумулятор емкостью 70 Ач. Он надежен, обеспечивает эффективную работу в течение пяти лет, имеет мощность холодного пуска 500А. Благодаря этим характеристикам вам не нужно бояться потери заряда аккумулятора даже при очень низких температурах. И для многих регионов России это актуальная проблема.

Многие закладывают в голову принцип выбора нового аккумулятора на ВАЗ 2114 по стоимости.Это совершенно неправильный подход. Честно говоря, дешевых, но надежных и эффективных аккумуляторов не существует ни для одной машины, в том числе и для ВАЗ 2114.

Поэтому на приобретении такой сборки настоятельно не рекомендуется экономить. Во-первых, обратите внимание на нюансы выбора, перечисленные в этом материале, после чего можно будет задуматься о стоимости аккумулятора. Но не наоборот.

Каждый автовладелец задается вопросом, какой аккумулятор купить. Какой аккумулятор подходит к его машине.Это касается любых мелочей. Ведь не нужно объяснять, что именно подобранный аккумулятор избавит вас от неприятных минут при запуске двигателя.

Самым главным критерием правильного выбора АКБ, является совет производителя. В первую очередь производитель ориентируется на рабочие характеристики генератора, а также на потребителей энергии. Но также важно знать, что такое АКБ. Автомобильные аккумуляторы Существуют три версии: обслуживаемая, не обслуживаемая и мало обслуживаемая.

Редко встретишь ныне обслуживаемые аккумуляторы, в связи с тем, что их практически не выпускают. В не обслуживаемых аккумуляторах пластины не заменяются, на крышках этих аккумуляторов нет отверстий и заглушек. Такие батареи эксплуатируются в теплом и сухом климате. А вот аккумуляторов на авто много — обслуживаются мало. Таких моделей аккумуляторов большинство. Есть и качественные, и дорогие, и простые, и дешевые.

Для определения правильности решения при выборе аккумулятора нужно знать следующее: емкость — первое.Он измеряется в амперах / час и указывает, что в течение определенного времени он должен производить определенный ток. Не забывайте, что емкость ослабляется при низких температурах. Чтобы в один из зимних дней вы не разочаровались, что ваша машина не завелась, нужно запомнить некоторые правила эксплуатации зимой.

  1. Необходимо постоянно следить за зарядом аккумулятора. Зеленый глазок индикатора указывает на степень зарядки, которая соответствует 70-75%. Этого достаточно для запуска двигателя при -20 С.
  2. Оценивая уровень зарядки необходимо помнить, аккумулятор изнашивается около 3-х лет, а пробег автомобиля составляет более 75 тыс. Км. уровень производства более 50%. Несмотря на то, что индикаторы будут указывать на высокую степень зарядки, истинные возможности аккумулятора уменьшились. Аккумулятор еще прослужит при теплых температурах, но в морозную погоду будут проблемы.
  3. При запуске двигателя убедитесь, что все сторонние пользователи в машине выключены.
  4. Если двигатель не заводится с первого раза, перед каждой следующей попыткой подождите несколько секунд, необходимых для прохождения электролита в батарее. Чем дольше пауза, тем выше напряжение в АКБ. Минимальное время выдержки должно быть не менее 10-15 секунд.

Какой выбрать аккумулятор на ВАЗ 2114 Видео.

ТОП-10 лучших аккумуляторов на ВАЗ 2114

Какой акб на ВАЗ 2115. Выбираем АКБ

Аккумуляторная батарея предназначена для работы двигателя, а также для питания приборов с отключенным двигателем или генератором.


«Не вкратце» про батарею

Батарейное устройство

Емкость автомобильного аккумулятора зависит от общего объема потребителей бортовой сети, стартера, генератора. Это свинцово-кислотный аккумулятор, электролит которого состоит из смеси дистиллированной воды и серной кислоты. Стандартный аккумулятор представляет собой одиночные батареи, соединенные между собой, помещенные в пластиковый корпус.

Характеристики АКБ на ВАЗ-2114

Относится к категории «не обслуживается»
, при наличии технологических заглушек на корпусе.Несмотря на разнообразие вмешательства водителя в конструкцию аккумулятора, срок его службы предопределен и составляет 3 года (средний). Температурные перепады, в том числе суровые зимы и жаркое лето, так или иначе сокращают срок службы АКБ.

Батарея щелочная на ВАЗ-2114

Итак, номинал бака, пусковой ток, резервная емкость являются важными параметрами качества АКБ. Ключевым считается последний показатель, который, кстати, не поддается проверке при выборе и покупке.

Вместимость

Несмотря на простоту конструкции, качество АКБ Разное — определяется брендом поставщика . Фактически, мощность 55 Аc соответствует эксплуатационным требованиям, если они соответствуют реальным значениям. Случаев, когда емкость не превышает 45А, нет.

Но Бич для АКБ стоит зимняя погода, что приводит к застыванию масла в картере двигателя.

Прокрутка коленвала требует больших усилий, что резко снижает заряд аккумулятора.Минусовая температура также снижает емкость аккумулятора.

Пусковое усилие, ток

ВАЗ 2114 комплектуется аккумулятором 6Т-55 емкостью 255 А . Однако на рынке есть батареи с амперметром выше 450 А. И это не вред, если машина работает в экстремальных условиях. Не пренебрегайте аккумуляторами с высоким пусковым током.

6Т-55 аккумулятор

Резервная емкость

АКБ предназначен для выдачи заказов 100 часов работы, с возвратом 25А. В напряжение на выводах 10,5В.
.

Такое напряжение свидетельствует об отсутствии заряда. Дело в том, что бортовой генератор не работает (отказывается) в длинной боевой части. Ток в сети нужен всегда. То есть аккумулятор вынужден питать всю бортовую сеть.

Исходя из этой ситуации, выбирать батареи следует ощущение высокого качества или высокого резервуара . Функциональными аналогами считаются гелиевые батареи, на ток 600 А.. Они имеют небольшие размеры, не подлежат замораживанию, имеют срок службы вдвое больше обычных сельскохозяйственных образцов. Гелиевые необслуживаемые аккумуляторы заправляются электролитом, который заполняет коробку (объем) аккумулятора специальным гелем, в дальнейшем затвердевая, но не теряя свойств.

Гелиевый автомобильный аккумулятор

Стоимость

из них в 4 раза превышает рыночную, но игра стоит свеч, потому что неприхотлива, надежна, долговечна и востребована не только для использования на автомобилях .

Подборка лучших АКБ

Приобретение АКБ на ВАЗ-2114 привязано к емкости, полярности, габаритам, производителю, году выпуска. Нормальный запуск двигателя зависит от емкости аккумулятора . На все ВАЗ-2114 производитель устанавливает 6Т-55, хотя специалисты-автоэлектрики считают оптимальными 60 А.

.

Полярность

Акб Ваз имеет прямую полярность что нужно выяснять при покупке. Его суть заключается в расположении клемм на крышке.

Прямая полярность определяется просто, для чего плюсовую клемму (большее сечение) нужно оставить слева, а минус, естественно, справа.

Батареи прямой и обратной полярности

Обратная полярность определяется подключением аккумуляторных банок и расположением клемм . Оба типа имеют одинаковое количество банок, силу тока, габариты. Так как длина проводов точно отрегулирована, перепутать и поставить аккумулятор с обратной полярностью сложно.

Чтобы не сжечь электронику (БЭУ) и сетевую систему, при установке нового аккумулятора сравните расположение старого.

Габариц.

Key Батарея габаритов не превышает 242 * 175 * 190 мм и помещается в предусмотренный для нее моторный отсек. Аккумулятор нестандартного размера или «чужой» аккумулятор не сможет поместиться в отведенный отсек и фиксируется, чтобы не болтаться.

Производителей

Мы доверяем Mutlu — в мире автомобильных аккумуляторов эталон надежности

Анализ рынка мнения специалистов, ремонтников, отзывы водителей на форумах сформировали список конкретных лидеров производителей аккумуляторов. Популярной стала марка «Тюмень» отечественного производителя. Продукция поставщика на ВАЗ 2114, ёмкостью 57-60 Ач работает в диапазоне 57-60 ° С . Отличаются набором быстрой зарядки, эффективным током. Они не прихотливы при запуске двигателя в сильный мороз.

В лидеры пробивается товаров «Зверь» (Иркутская область), который рекомендует и выпускает 6ст-57.
, 6ст-70 Ач .

Предлагается и рекомендуется такая же емкость аккумулятора (70 Ач). зарубежных производителей «Варта» и «Бош» но с пробегом 4-5 лет.

Год выпуска

Дата производителя играет важную роль, и информация о ней находится на крышке. Дело в том, что срок хранения товара на складе и продолжительность эксплуатации не взаимосвязаны. Это вызвано отсутствием связи между температурным режимом, контролем степени заряда и сроком службы.

Видео Как правильно выбрать аккумулятор на ВАЗ-2114

Как выбрать аккумуляторы для автомобилей ВАЗ? Несмотря на обилие иномарок, наибольшее количество автомобилей в России представлено маркой Lada (LADA) производства ВАЗ.Поскольку существует множество различных моделей и модификаций, владельцев волнует вопрос: аккумулятор какой марки и параметров можно считать оптимальным для той или иной машины? Итак, выбираем аккумулятор на ВАЗ.

Общие правила выбора АКБ для автомобилей ВАЗ

1.
Обязательно укажите ключевые параметры. К ним относятся индикаторов емкости, полярности, типа клемм , а также — аккумуляторов типоразмера .
2.
Указанная емкость на приобретенном аккумуляторе должна совпадать по величине с имеющейся или незначительно отличаться.Это влияет на электрооборудование каждого автомобиля. 3.
Проверьте размер батареи. Аккумулятор на ВАЗе, как правило, имеет показатели 242х175х190 мм . Это общепринятые габаритные размеры для всех моделей ВАЗ. Однако лучше прогрессировать и измерить имеющийся аккумулятор. 4.
Следующий пункт — определение индикатора полярности. С этим сложностей возникнуть не должно, так как практически все модели ВАЗ различаются прямой полярностью. 5. При уточнении типа клемм необходимо знать следующее. Для моделей ВАЗ оптимальный аккумулятор с европейскими клеммами, которые, в отличие от азиатских, более объемные. И отсутствие ниток отличает их от американских. 6.
Перед покупкой АКБ стоит учесть условия, в которых будет эксплуатироваться автомат. Если машина будет ездить на морозе, специалисты советуют выбирать акб мощностью, скажем, на 5-10 Ач больше стандартной.Еще один момент при выборе связан с особенностями езды по дороге. В этом случае лучше выбрать аккумулятор с дополнительной фиксацией пластин.

Особенности выбора акб для отдельных моделей ВАЗ

ВАЗ 2105, 2106, 2107. Стоит учесть, какой тип двигателя установлен — инжекторный или карбюраторный. Для машин с карбюраторным мотором объемом менее 1,2 л подходит аккумулятор на 44 Ач, до 1,8 л — 55 Ач, свыше — 62-66 Ач.Если есть инжекторный двигатель объемом менее 1,6 л, нужен аккумулятор на 44 Ач, от 1,6 до 2,5 л — уже на 55 Ач. ВАЗ 2109. Стоит выбирать в зависимости от климата. Для района с умеренными морозами оптимален свинцово-кислотный аккумулятор, а при более теплом климате стоит выбрать необслуживающий акб. ВАЗ 2110, 2111 и 2112. В заводской комплектации комплектуется свинцово-кислотным аккумулятором с емкостью жидкого электролита 55 Ач, он считается наиболее оптимальным для системы eleto указанных моделей.Этот аккумулятор относится к разряду необслуживаемых. И при замене необходимо учитывать фактор наличия установленного на машине дополнительного оборудования. Чем больше, тем мощнее нужен аккумулятор. ВАЗ 2114, 2115. Акб подходит на 55 — 62 Ач. Если вы выбираете между классическим и необслуживаемым акб, все больше водителей предпочитают второй вариант. Приора, Лада Ларгус. При заводской сборке стоит аккумулятор на 55 Ач.Но в Lada Largus стоит аккумулятор с обратной полярностью. Не требует обслуживания, показатель емкости — 70 Ач.

Рекомендации по выбору АКБ от «Первой перезарядной компании»

Мы рекомендуем аккумуляторы следующих марок: AutoPart, Ecostart, JP Dynamic и 1Storm. Эти марки представлены батареями европейского производства. В них реализованы современные технические решения. Эти аккумуляторы отличаются хорошей пусковой мощностью, минимальным значением саморазряда, повышенной безопасностью.Они отлично подходят для нашего климата — за счет повышенной морозостойкости. Важно, что данные ABB отлично зарекомендовали себя в различных ситуациях.

Типы автомобильных аккумуляторов?

Устройство свинцово-кислотных аккумуляторов

Самый распространенный тип аккумуляторов — свинцово-кислотные. В таких батареях обычный электролит представляет собой смесь дистиллированной воды и серной кислоты.

Аккумуляторная батарея AGM

Другой тип аккумуляторов основан на технологии AGM (Absorbent Glass Mat).Электролит абсорбируется стекловолокном.

Устройство гелевой (не обслуживаемой) батареи

Третий вид акб называется гелевым. Технология называется GEL, в гелевых батареях электролит загущен до состояния геля силикагеля. В них уровень жидкости не проверять — он не обслуживается . У них очень высокий уровень электролита по пластинам и запас по плотности. Один запуск двигателя забирает у аккумулятора столько энергии, сколько получает от генератора в течение 10-15 минут при нормальных оборотах.Зимний разряд побольше. Аккумулятор может заряжаться не полностью, если ежедневные поездки короткие. Генератор не успевает зарядить аккумулятор, поэтому иногда рекомендуется заряжать аккумулятор от зарядного устройства в домашних условиях. Летом необходимо проверять уровень электролита, потому что от тепла испаряется. Она испаряется даже на машине. При необходимости (если конструкция позволяет доливать дистиллированную воду (и только воду).

Какую выбрать емкость аккумулятора?

Стандартный АКБ ВАЗ 2110 имеет емкость 55Ач.Допускается выбирать емкость чуть выше паспортной, что позволит немного лучше заводиться зимой. Разница 55Ah и 60 часов незначительна, но аккумулятор 55Ac зарядится полностью быстрее.

Как продлить срок службы батареи?

Срок службы батареи зависит от модели и обслуживания и может сильно варьироваться (от 1 до 9 лет). Считается, что 4 года жизни — это разумный минимум. Оптимальная температура хранения аккумулятора — 0 градусов. При этом процесс саморазряда и электролита сломает корпус даже при полном разряде.Регулярно проверяйте уровень электролита. При необходимости поддерживайте его в обычном режиме и не забывайте заряжать аккумулятор. Не допускайте полной разрядки аккумулятора. Если аккумулятор хотя бы один раз полностью разрядится, это значительно сократит срок его службы. Чтобы не было проблем с запуском двигателя зимой, следует поддерживать аккумулятор заряженным, а также следить за плотностью электролита. Плотность электролита полностью заряженной батареи 1,27 за 20 с увеличивается на 0,007 на каждые 10 градусов.ниже 20. Т.е. Плотность электролита нормально заряженного аккумулятора при -20 градусах будет 1,3. На зиму плотность электролита нужно поднять до 1,29. Так же и для высоких температур, при +40 при окружающем воздухе 1,25 — это нормально, аккумулятор полностью заряжен.

Как определить состояние батареи?

Если в одной из банок АКБ по сравнению с остальными резко упала плотность, а уровень остался прежним — идет сульфатный процесс, а это начало смерти АКБ (мутный электролит).Бэд банк не только ток не сдает, но и судится с соседнего, т.е. выехать без проблем днем ​​можно утром в тёплую погоду и не бегать … в домашних (гаражных) условиях ничего не делать практически невозможно, пора искать замену.

Почему быстро разряжается аккумулятор?

Если аккумулятор быстро разряжается, значит, ежедневный пробег отсутствует, поэтому генератор полностью заряжен. Либо есть ток утечки АКБ. Если нет желания обслуживать аккумулятор, то рекомендуется выбрать гелевый аккумулятор.Если на машине с заглушенным двигателем не слушать музыку с включенными фарами и нет утечки тока, то она служит минимум 4 года и не подведет. Перед покупкой ознакомьтесь с последними отзывами и тестами АКБ. При покупке акб обращайте внимание на то, что он свежий. Если залить и зарядить, то до 3 месяцев после изготовления, а если закинули, то до 6 месяцев. Цена на аккумулятор зависит от его типа, марки и емкости (средняя цена 2500 — 4000 руб.).Купить аккумулятор можно в интернет-магазинах.

Читайте также на сайте

Никто не хочет попасть в аварию, но, к сожалению, мы не можем это контролировать. К счастью, все автомобили оснащены дополнительной системой безопасности, известной как подушки безопасности. Согласно институ …

Зачем нужен широкий диапазон моментов затяжки? Для того, чтобы на всех динамоклах была ошибка. Лучше взять момент посередине диапазона. Минимально допустимый максимальный момент затяжки.Например: 100-110 Н · м. На …

Автомобильный аккумулятор предназначен для запуска двигателя и в качестве резервного источника питания основных потребителей, если генератор не работает или отключился. Кроме того, при включенном двигателе аккумулятор помогает генератору в переходных режимах или при сглаживании пульсаций напряжения.

Для того, чтобы правильно выбрать аккумулятор для автомобиля, необходимо знать некоторые особенности их устройств и условия, при которых они сохраняют достаточную эффективность.

На все легковые автомобили в настоящее время устанавливают свинцово-кислотные акб. Стандартный аккумулятор этого типа состоит из шести аккумуляторов, соединенных вместе в пластиковый корпус непроводящего тока. Электроды из сплава Swing имеют решетчатую структуру. Их погружают в электролит из раствора серной кислоты. На верхней панели есть отверстия для подачи газа при зарядке. Аккумулятор при установке на автомат подключается к двум свинцовым выводам, размещенным на этой панели. Для удобства нанесите «положительный» вывод, тем толще «отрицательный».

Электролит чувствителен к температуре. Оптимальным для максимально эффективной работы аккумулятора является — плюс 27 градусов. При этом понижение температуры воздуха до минус восемнадцати градусов приводит к падению до 50 процентов емкости аккумуляторного бака. В физическом смысле это означает, что для запуска машины требуется в два раза больше энергии. Кроме того, необходимо помнить, что при серьезной отрицательной температуре подзарядка практически не производится. Аккумулятор работает на износ.При высоких температурах часто происходит так называемый «горячий запуск». Горячий двигатель для запуска требует значительно больше электроэнергии.

Таким образом, когда сделан выбор, какой аккумулятор для ВАЗ 2114 нужно покупать, то необходимо учитывать емкость аккумулятора, номинальную мощность потребителей энергии, особенно при запуске, а также страну производитель. Последнее условие связано с тем, что желательно, чтобы в этой стране температурный режим был похож на российский.

Специалисты рекомендуют определять емкость покупаемого акб по формуле — (максимальный ток протока генератора в АКБ) х 0,75. То есть, если на ВАЗ 2114 установлен генератор на 80 Ач, то для этой машины потребуется аккумулятор емкостью 60 Ач.

При этом гораздо большей емкости аккумулятор не устанавливается, т.к. мощности генератора может не хватить для подзарядки.

Выбирая АКБ на ВАЗ 2114, необходимо обращать внимание на следующие основные параметры АКБ: размер, емкость, полярность, тип и страна производителя, год выпуска.

  1. Одним из важнейших показателей, определяющих, какой аккумулятор на ВАЗ 2114 стоит выбрать, является размер покупаемого аккумулятора. Это оказывается важным, потому что место в моторном отсеке для этого агрегата специально оборудовано. Провода для подключения имеют строго определенную длину. Любая батарея нестандартного размера либо не войдет в место установки, либо будет болтаться, так как закрепить ее будет невозможно. Стандартные размеры на ВАЗ 2114 — 242х175х190 мм.
  2. Емкость также должна соответствовать требуемым параметрам для нормального запуска двигателя в любых погодных и температурных условиях. Производитель ставит АКБ на ВАЗ 2114 емкостью 55 Ач. Специалисты рекомендуют приобретать анкб емкостью 60 Ач. Автоэлектрики считают такие аккумуляторы наиболее оптимальными для автомобилей ВАЗ.
  3. Для европейских и американских автомобилей выбран АКБ с обратной полярностью.
  4. Особое внимание при выборе АКБ для ВАЗ 2114 стоит обратить на год выпуска аккумулятора.Любая батарея, срок хранения которой превышает один год с даты выпуска, должна пройти процедуру подзарядки.
  5. Аккумулятор продается в двух состояниях: заправленный электролитом и заряженный до необходимой емкости, а также высушенный. После покупки аналогичного аккумулятора необходимо залить кислоту плотностью 1,25 г / куб. СМ. и выше. Эту плотность следует измерять при температуре воздуха плюс 25 градусов. Через двадцать минут после заправки аккумулятора необходимо проверить натяжение банок без нагрузки.Нормальные рабочие показания — 12,5 В и более. Если напряжение меньше 12,5 В, то аккумулятор требует дополнительной зарядки. Если показания составляют 10,5 В или меньше этого значения, значит, это заводской брак и применять такой агрегат нельзя.

Если автовладелец собрался покупать аккумулятор на ВАЗ 2114, то он должен посмотреть, кто страна производитель аккумулятора и какой марки предлагается. На форумах и некоторых ресурсах в Интернете есть результаты опросов водителей с рекомендациями производителей AKB:

  • Безоговорочный лидер такого обзора — аккумулятор под брендом Тюмень, производство тюменской аккумуляторной упаковки.Для ВАЗ 2114 подходят два типа аккумуляторов этой марки — 6ст-57 и 6ст-60. У них емкость соответственно 57 Ач и 60 Ач. Температурный режим от минус сорока до плюс шестидесяти градусов. Эти аккумуляторы обладают хорошей скоростью заряда и большим разрядным током, что обеспечивает стабильный запуск двигателя в любых условиях;
  • Следующим в рейтинге

  • идет аккумулятор под маркой «Зверь». Производитель — «Аккумуляторные технологии» со штаб-квартирой в Иркутской области. Для ваз подходят аккумуляторы емкостью 55, 60, 66 и 70 Ач.На эти аккумуляторы хорошая гарантия три года;
  • Аккумуляторные батареи

  • «Варта» пользуются большой популярностью. Разработчик этого продукта американская компания Johnson Controls обеспечила высокие показатели этой батареи при эксплуатации. Гарантийный срок также составляет три года. На практике многие водители используют его по четыре года;
  • многие автолюбители рекомендуют АКБ Bosch с аккумулятором ёмкостью 70 Ач. В первую очередь из-за их высокой надежности, позволяющей эксплуатировать этот аккумулятор в течение пяти лет.Имеет ток холодного пуска 500 А, это высокий показатель, позволяющий спокойно эксплуатировать эту батарею при низких температурах.

Когда перед водителем встает задача выбора АКБ, он смотрит на последнюю строчку, и сколько стоит аккумулятор на ВАЗ 2114. Конечно, идеальный вариант — когда оптимальное соотношение «цена — емкость составляет надежный.»

Тем не менее, опытным водителям и ремонтникам рекомендуется не экономить на таком важном узле, как аккумулятор.Мощный и надежный аккумулятор — стабильный старт при минимальной температуре.

Аккумулятор — это устройство, по сути, расходное, которое используется в каждом современном автомобиле. Поскольку производителей АКБ на сегодняшний день очень много, покупка устройства может вызвать затруднения у автовладельца. Подробнее о том, как выбрать аккумулятор на ВАЗ 2114 и 2115, и какие нюансы нужно учесть, мы расскажем в этой статье.

[Скрыть]

В каких случаях нужно менять родную батарею?

Если вы не знаете, какой аккумулятор лучше выбрать на ВАЗ 2115, то мы готовы помочь вам в этом вопросе.Но для начала разберемся, в каких случаях АКБ подлежит замене. Как правило, потребность в этом одна — аккумулятор разряжен полностью и частично и уже не может держать заряд. Если устройство даже после зарядки не может запустить стартер для запуска двигателя, это говорит о том, что, скорее всего, устройство отработало свой ресурс. Даже съел после зарядки аккумулятор запускает двигатель, но при последующих попытках завести ничего не выходит, то, скорее всего, в ближайшее время будет необходимость покупать новое устройство.

Как выбрать аккумулятор на ВАЗ четырнадцатой и пятнадцатой модели?

Выбирая аккумулятор на ВАЗ 2114 в Москве или любом другом городе, нужно руководствоваться несколькими факторами:

  • емкость покупающего устройства;
  • показатель его номинальной потребляемой мощности;
  • марка, производитель прибора.

Если вы хотите, чтобы аккумулятор хорошо держал заряд, нужно правильно рассчитать бак устройства, а для этого в свою очередь есть простая формула.Для расчета емкости максимальный выходной ток генераторного узла необходимо умножить на 0,75. Например, если вы используете генератор, максимальный ток которого составляет 70 Ач, то параметр АКБ должен быть 52,5 Ач. В этом случае наиболее подходящий вариант для вас — аккумулятор емкостью 55 Ач.

Кроме того, покупая аккумулятор на ВАЗ 2115, следует учитывать еще и объем двигателя — в этом случае оптимальным вариантом является аккумулятор емкостью 55-66 Ач. Не стоит выбирать более высокую емкость, так как мощности генераторного узла может не хватить для его зарядки.

Параметры

Для выбора устройства, которое прослужит вам более одного года без сбоев, необходимо учитывать не только приведенные выше факторы, но и определенные параметры, а именно:

  1. Габаритные размеры. Как известно, для крепления АКБ в моторном отсеке есть специальное место с площадкой, а провода для питания аккумулятора ограничены по длине. В том случае, если вы купите батарею, которая не работает по габаритам, ее просто не удастся установить на место установки.Причем, скорее всего, он не будет записывать, но в этом случае работа от батареи будет невозможна. Поэтому в первую очередь, покупая устройство, обратите внимание на размеры, они подробно указаны в сервисной книжке.
  2. Вместимость. Что касается этого момента, мы уже объясняли, что лучшим вариантом будет аккумулятор на 55-66 Ач.
  3. Полярность устройства. Как известно, производители аккумуляторов из США и Европы в большинстве случаев используют аккумуляторы с обратной полярностью.Прямая полярность характеризуется тем, что расположена с левой стороны, а отрицательная — с правой. Как правило, устройства с прямой полярностью выпускаются японскими или корейскими брендами.
  4. Год выпуска прибора. Учтите, что если устройство было выпущено более двенадцати месяцев назад, то от него лучше отказаться. Аккумулятор за такое время простоя нужно периодически подзаряжать, но далеко не факт, что это делал продавец. «Свежий» аппарат будет лучше.
  5. Уровень заряда тоже нужно обращать внимание на заряд устройства. В зависимости от конструктивных особенностей устройство может заправляться с помощью электролита или сушиться по своей структуре. Если вы предпочитаете сухие батареи, то учтите, что они обязательны перед эксплуатацией. В этом случае плотность раствора должна быть не менее 1,25 кг / см3. Процедуру проверки плотности устройства следует проводить при температуре окружающей среды, которая составляет 25 градусов тепла.
    После зарядки аккумулятора необходимо подождать не менее 20 минут перед проверкой напряжения, при этом его следует проверять без нагрузки. Если аккумулятор в порядке, параметр напряжения должен быть не менее 12,5 вольт. Если при проверке выяснилось, что напряжение ниже, то аккумулятор нужно будет дополнительно подзарядить. В том случае, если индикатор напряжения 10,5 вольт и ниже, то, скорее всего, вы купили заводской брак, чтобы вернуть его продавцу. В этом случае зарядка устройства не поможет, и его работа некорректна (автор видео — Александр Шестопалов).

Производители и бренды

Если говорить о производителях аккумуляторов, то этот параметр тоже важен.

В результате анализа рынка, а также покупательского спроса наш ресурс подготовил список АКБ, наиболее подходящих для отечественных автомобилей как по параметрам, так и по стоимости:

  1. Тюменский производитель на сегодняшний день — рынок лидер, в частности, в сегменте аккумуляторов на ВАЗ 2114 и 2115. Ассортимент продукции Тюмени достаточно огромен, но наши соотечественники выделяют две модели, использование которых наиболее оптимально — 6-я 57 и 6-я 60.Емкость этих Устройств составляет 57 и 60 Ач соответственно. Как показывает практика, устройства могут работать в диапазоне температур от -40 до +60 градусов. Они без проблем и быстро заряжаются при необходимости, позволяют выдавать максимально эффективный ток, а также гарантируют запуск силового агрегата практически при любых погодных условиях.
  2. Не менее популярны у наших соотечественников устройства от производителя «Аккумуляторные Технологии», который их выпускает. «Этот производитель тоже из России, подбираются наиболее оптимальные варианты устройств в соответствии с требуемой тарой.Одной из особенностей таких АКБ является то, что производитель дает на них гарантию 36 месяцев, что бывает не так часто.
  3. Еще одна удачная версия приборов для отечественного ВАЗа — производитель «Варта». За долгие годы работы на российском рынке американский производитель зарекомендовал себя как бренд, производящий качественные аккумуляторы. На практике такой АКБ отличается высоким КПД, а также надежной работой. Этот производитель также гарантирует бесперебойную работу АКБ в течение трех лет, хотя фактически такие устройства могут служить пять лет.
  4. Конечно, список лучших производителей невозможно было бы составить без бренда Bosch. Этот бренд универсален, так как выпускает множество разновидностей различных узлов и устройств для современных автомобилей. В этом случае лучше остановить свой выбор на аккумуляторе, емкость которого составляет 70 Ач. Такие устройства достаточно надежны, как правило, в среднем ресурс их эксплуатации колеблется около пяти лет. Ток холодного пуска в данном случае составляет 500 ампер.
    Эти характеристики позволяют без проблем запустить двигатель отечественного автомобиля даже в сильный мороз, что особенно актуально для жителей центральных и северных регионов.

Цена вопроса

Видео «Как проверить состояние батареи?»

Подробный урок по диагностике автомобильного аккумулятора приведен на видео ниже (автор — каналы решений).

Как правильно выбрать аккумулятор? Какая батарея лучше обслуживается или обслуживается?

Аккумулятор — это устройство для хранения энергии в химической форме, которая может использоваться как электричество. Батарея работает за счет того, что два разных металла, находясь в кислотном растворе, производят электричество.

Производительность аккумулятора

Ниже приведены некоторые важные характеристики аккумуляторов, которые помогут вам выбрать правильный аккумулятор для автомобиля.
Аккумулятор имеет 100% КПД при 27 ° С. При -18 пусковые характеристики того же аккумулятора падают до 40%. Теперь, чтобы запустить двигатель, у вас должно быть вдвое больше энергии, чем было необходимо при 27 ° C. Обратите внимание на этот важный момент. Есть потребность в больших батареях, особенно в холодном климате.

Ток холодного пуска показывает способность аккумулятора запускаться в условиях очень холодной погоды.Он показывает количество ампер, которое вырабатывает аккумулятор в течение 30 секунд при -18 ° C без падения напряжения ниже 7,2 В (минимальный уровень, необходимый для надежного запуска). Чем выше этот показатель, тем больше пусковая мощность аккумулятора.
Емкость показывает время в минутах, в течение которого аккумулятор обеспечивает 25 ампер при температуре 27 ° C.Этот коэффициент представляет собой время, в течение которого аккумулятор обеспечивает все вспомогательные устройства в автомобиле ночью и в условиях плохой погоды с неисправным зарядом. генератор.
Работает в холодных погодных условиях. Зимой при -18 ° C аккумулятор будет плохо заряжаться из-за увеличения внутреннего сопротивления. При коротких поездках зимой энергия, затрачиваемая аккумулятором на запуск, не компенсируется. В результате аккумулятор работает на износ, постоянно разряжается и со временем выходит из строя.

«Горячий старт». В летние месяцы после длительных поездок двигатель сильно греется, и часто бывает, что снова сложно завести. Такой «горячий запуск» иногда требует столько же мощности, сколько в холодную погоду, или даже больше.Особенно это касается двигателей высокого уровня с большим рабочим объемом и автомобилей с кондиционером. Это еще раз подчеркивает важность правильного выбора аккумулятора в соответствии с двигателем автомобиля.

Как правильно выбрать аккумулятор?

Наверное, у каждого автомобилиста наступает такой момент, когда возиться со старым аккумулятором становится слишком хлопотно. Особенно, если на дворе зима и потрескивающие морозы. Постоянные проблемы с запуском двигателя, бесконечная «домашняя» подзарядка и опасения, что крепированная активная масса в самый неподходящий момент закроется пластиной, после чего вас на буксире потянет домой с какого-то перекрестка.Напрашивается вывод: нужен новый аккумулятор. Но что?
Все стартерные батареи делятся на три категории:

1. Обслуживаемые или ремонтопригодные

2. Низкие

3. Подходящие.

Батареи для обслуживания до сих пор в продаже, хотя десять лет назад их было почти абсолютное большинство. Сейчас их производят всего несколько российских заводов и даже в нескольких странах бывшего социалистического лагеря. Их легко узнать по корпусу из эбонита и черной мастике, которая сверху залита.Этот аккумулятор дает возможность заменить блок пластин одной или нескольких банок, если между пластинами произошло короткое замыкание. Но подавляющее большинство автомобилистов этим заниматься не будут. К тому же корпус из эбонита дешевле в производстве, менее прочен, чем пластик, и при выстреле из него. У мастики тоже есть существенный недостаток — со временем от грязи и перепадов температуры она теряет изоляционные свойства, из-за чего аккумулятор начинает очень быстро самопроизвольно разряжаться.

Владелец основного аккумулятора просто лишен возможности что-то с ним делать: на крышке такого аккумулятора нет отверстий и пробок для топлива.Это специальные аккумуляторы, предназначенные для определенных (читай, идеальных) условий эксплуатации с мягким климатом, погашением долга. Они очень дороги и подходят не для всех автомобилей.

Большинство выпускаемых в мире автомобильных аккумуляторов не обслуживаются. У них нет таких жестких ограничений по эксплуатации и они представлены на рынке шире, от относительно дешевых и простых до дорогих, качественных, буквально отшлифованных современных технологий.

Допустим, вы решили купить аккумулятор, а где и как? Во-первых — где.Лучше всего обратиться в солидную фирму, где вам быстро подберут то, что вам нужно. И они дадут реальную гарантию. Если у фирмы есть своя мастерская гарантийного обслуживания, это то, что нужно. Что теперь.

Дадим несколько рекомендаций.
Престиж и известность бренда аккумуляторов имеют решающее значение при покупке, но также необходимо учитывать некоторые технические моменты. Конечно, химический состав плит, технология их изготовления продавцу вряд ли будут известны.Это нужно покупателю? Лучше обратить внимание на то, что вы видите сами. Например, на упакованных пластинах (каждая пластина упакована в микропористый конверсионный сепаратор), что предотвращает короткое замыкание между ними из-за сползания активной массы и, соответственно, продлевает срок службы батареи. Такие пакеты хорошо видны, если открыть заливную пробку. Обратите внимание на пробки. Известно, что при зарядке аккумулятора вода из электролита испаряется и при электролизе разлагается на водород и кислород.

Чтобы аккумулятор не взорвался, в пробках сделано небольшое отверстие для выпуска газов. В самых простых (и дешевых) аккумуляторах проделайте лишь небольшое отверстие, которое может быстро забить грязь. В более дорогих заглушках вроде клапана, не дающего разбрызгивания электролита, с полостью для конденсата паров. Лучше всего, если в пробках не будет отверстий, а в крышке аккумуляторной батареи будет система полостей для конденсации воды, а также единый канал отвода газов, как в необслуживаемых аккумуляторах.

A Аккумуляторы с низким уровнем обслуживания поставляются производителями в высушенном (как и большинство обслуживаемых) или залитом электролитом на заводе.Если вы в будущем купите аккумулятор, лучше покупать сушеное платье, у него большой срок хранения. Для того, чтобы привести в рабочее состояние, нужно залить электролит. Аккумуляторы заправленные на заводе готовы к работе. Электролит для них готовится специалистами из качественных компонентов и содержит множество (иногда более двадцати) добавок, препятствующих сульфатированию, ползучести по активной массе и т. Д. Надо сказать, что в продаже появились специальные модификаторы, содержащие такие добавки, но они не вызывают доверия.Есть еще один плюс замораживания батареек. Перед тем, как попасть в торговую сеть, они проходят специальную зарядку с контролем параметров на специальном оборудовании. При этом выявить некачественные батареи проще.

Цена аккумулятора практически прямо пропорциональна его емкости. И третья характеристика — это пусковой ток (измеряется в амперах), то есть ток, подаваемый на пускатель при пуске. На батареях он может отображаться в четырех разных системах:

1.ГОСТ (внутренний)

2. EN (Единый европейский стандарт)

3. SAE (Американский стандарт)

Последний, немецкий стандарт ближе всего к нашему ГОСТу и на большинстве европейских аккумуляторов установлен «по умолчанию», т.е. Когда стандартная система не указана. Чем он больше, тем быстрее и с большей силой стартер проверит двигатель.
Лучше, если вы купите аккумулятор с теми характеристиками, которые указаны в инструкции по эксплуатации вашего автомобиля: так он прослужит вам дольше с минимальными затратами.Вы можете сэкономить и купить батарею меньшего размера, но она будет служить вам меньше обычного времени и будет трудно справиться с зимним запуском. Купив аккумулятор даже чуть большей емкости, по сроку службы вы не выиграете, т.к. постоянный выход аккумулятора из строя приведет к сульфату пластины, а деньги потеряете. Увлекаться повышенным пусковым током тоже не следует: сжечь стартер. Лучше поменяйте масло в двигателе, и с запуском проблем не будет.

В последнее время рынок страны переполнен некачественными товарами и подделками.Аккумуляторы не исключение. Есть несколько признаков, по которым можно с достаточной точностью отличить от подделки. Первое и, пожалуй, главное: на аккумуляторе должна быть указана страна-производитель и завод-производитель, лучше с адресом. Второй — должна быть указана дата изготовления, что очень важно, если аккумулятор залит. К каждой батарее должен быть приложен технический паспорт, но наличие инструкции не является обязательным.Это связано с тем, что на Западе аккумуляторы в розницу почти не продаются, специалисты устанавливаются на СТО. Третье — качественный аккумулятор, немыслимый без качественного корпуса, хороших пробок и плавных выводных клемм, часто смазанных технической защитной смазкой от окисления и прикрытых цветными пластиковыми колпачками.

Основная задача АКБ — источник тока для запуска двигателя. Сила тока, необходимая для включения холодного двигателя, различается в зависимости от автомобиля.Это зависит от размера и диаметра поршня, количества цилиндров, соотношения прокручиваемый двигатель / стартер, сопротивления цепи, температуры, вязкости моторного масла и нагрузки вспомогательных устройств. Четырехцилиндровому двигателю может потребоваться такое же значение пускового тока, что и восьмицилиндровому с большим рабочим объемом. Когда к автомобилю подбирается оригинальная аккумуляторная техника, то учитываются все эти факторы.

Второе назначение аккумулятора — восполнение требований к нагрузке транспортного средства, когда они превышают способность поставлять энергию.Система зарядки может выдерживать электрическую нагрузку при нормальных условиях движения. Однако, если двигатель работает на холостом ходу, аккумулятор может восполнить энергию для вспомогательных устройств. Это происходит при регулярных остановках и возобновлении движения при нормальной нагрузке вспомогательных устройств. Аккумулятор должен заполнять электрическую нагрузку автомобиля при выходе из строя зарядного устройства. При замене автомобильного аккумулятора используйте эквивалентный оригинальный аккумулятор. Если требуется больший коэффициент надежности, используйте аккумулятор большей емкости.

Третье назначение аккумулятора — это действие в качестве стабилизатора напряжения в зарядном устройстве. Время от времени в электрической системе возникают очень высокие переходные напряжения. Это может произойти при замыкании или размыкании цепи и т. Д. Батарея частично поглощает и значительно сглаживает эти пиковые напряжения и защищает полупроводниковые компоненты от выхода из строя.

Берегите аккумулятор!

Чем холоднее на улице, тем больше проблем у водителей. Одно из главных — как на морозе заводить двигатель.И тут сначала дает себя узнать аккумулятор. Именно на него ложится наибольшая нагрузка на морозе: запуск двигателя требует гораздо большего усилия. Чтобы запустить стартер холодного коленчатого вала двигателя, аккумулятор должен отдавать гораздо больше энергии. При этом не забывайте, что восстановление работоспособности аккумулятора происходит не мгновенно, а через некоторое время: загустевший на морозе электролит медленно проникает внутрь пластин. Поэтому повторную попытку запуска двигателя рекомендуется производить только через несколько минут.К тому же на морозе аккумулятор при работе стартера очень быстро разряжается. Некоторые водители, пытаясь завести «замороженный» двигатель, непрерывно один раз включают стартер. В результате такого насилия аккумулятор очень быстро «сохнет» — окончательно и бесповоротно: пластины аккумулятора, не удерживая чрезмерных нагрузок, начинают размножаться и поворачиваться.

Судя по всему, о необходимости регулярного ухода за аккумулятором говорить не приходится, нужно раз в неделю проверять уровень электролита в банках и при необходимости доливать дистиллированную воду.Если аккум в обслуживании — ухода поменьше. Но все же внимание будет обращено, необходимо периодически проверять натяжение приводного ремня, и при самых первых признаках снижения мощности аккумулятор необходимо подзарядить. А теперь речь пойдет о том, как быстро и наименее безболезненно использовать двигатель на морозе:

Первое — очевидно. Своевременно и своевременно заменяйте масло. Лучше — на импортный, ибо наш (в том числе и фасованный) часто имеет неприятную особенность превращаться в иней в кисель или вовсе замерзать.Не говоря уже о том, как такое масло будет смазывать детали двигателя, аккумулятор с ним должен будет быть очень герметичным, а дни его будут считаться.

Вторая — свечи. На зиму лучше устанавливать новые. Но это теория, а на практике часто встречаются такие факторы, как «экономия» или ее отсутствие в нужный момент. Ибо, пока двигатель запускается нормально, многие даже не помнят, что в нем свечи … если свечи еще старые — установите в них необходимый зазор, который постоянно увеличивается из-за перегорания электродов.Лучше сделать это заранее, иначе придется забирать, когда нужно ехать. В крайнем случае, если двигатель не заводится, зазор можно установить менее рекомендуемым, но в этом случае электроды будут гореть еще быстрее. В сильные морозы перед включением стартера «прогрейте» аккумулятор — включите через пару минут. И не пытайтесь сразу запустить двигатель. Сначала несколько коротких включений стартера, вбиваем поршни в цилиндры, чтобы масло слегка загустело.И после этого попробуйте запустить его. Если двигатель не запускается с первой попытки, не выключайте сразу стартер. Наиболее оптимальный режим запуска двигателя — серия попыток по 10-15 секунд с трехминутными перерывами.

Diarrheagenic Escherichia coli

Abstract

Большинство штаммов Escherichia coli безвредно живут в кишечнике и редко вызывают заболевания у здоровых людей. Тем не менее, ряд патогенных штаммов могут вызывать диарею или внекишечные заболевания как у здоровых людей, так и у людей с ослабленным иммунитетом.Диарейные заболевания — серьезная проблема общественного здравоохранения и основная причина заболеваемости и смертности младенцев и детей младшего возраста, особенно в развивающихся странах. Штаммы E. coli , вызывающие диарею, эволюционировали путем приобретения посредством горизонтального переноса генов определенного набора характеристик, которые успешно сохраняются в организме хозяина. В соответствии с группой приобретенных детерминант вирулентности были сформированы специфические комбинации, определяющие известные в настоящее время патотипы E. coli , которые в совокупности известны как диареагенные E.coli . В этом обзоре мы собрали информацию о текущих определениях, серотипах, происхождении, механизмах вирулентности, эпидемиологии и диагностике основных диарейных патотипов E. coli .

Ключевые слова: Escherichia coli , Диарея, Патогенные механизмы, Фактор вирулентности, Эпидемиология

Род Escherichia , названный в честь немецкого педиатра Теодора Эшериха, состоит из факультативно-анаэробных бактерий, относящихся к грамотрицательным бактериям. семейство Enterobacteriaceae.1 Вид типа рода Escherichia coli широко распространен, где он является основным факультативным анаэробом, населяющим толстую кишку людей и теплокровных животных. у здоровых людей ряд патогенных штаммов может вызывать кишечные и внекишечные заболевания как у здоровых, так и у людей с ослабленным иммунитетом3.

Диарейные заболевания — серьезная проблема общественного здравоохранения и основная причина заболеваемости и смертности младенцев и детей раннего возраста.4 Страны с низким и средним уровнем доходов в Африке, Азии и Латинской Америке являются наиболее пострадавшими регионами, где диарейные заболевания чаще встречаются со смертельным исходом, главным образом из-за плохих условий жизни (неадекватное водоснабжение, плохая гигиена окружающей среды и санитария, а также недостаточное образование) .5

Штаммы E. coli , участвующие в диарейных заболеваниях, являются одними из наиболее важных из различных этиологических агентов диареи, штаммы которых эволюционировали в результате приобретения посредством горизонтального переноса генов определенного набора характеристик, которые успешно проявили себя. упорствовал в хосте.3, 5, 6 В соответствии с группой приобретенных детерминант вирулентности были сформированы определенные комбинации, определяющие известные в настоящее время патотипы E. coli , которые в совокупности известны как диареагенные E. coli (DEC) .6 Патотипы DEC различаются в отношении их предпочтительные места колонизации хозяином, механизмы вирулентности и вытекающие из них клинические симптомы и последствия, и классифицируются как энтеропатогенные E. coli (EPEC), энтерогеморрагические (продуцирующие токсин Shiga) E.coli (EHEC / STEC), энтероагрегант E. coli (EAEC), энтеротоксигенный E. coli (ETEC) и энтероинвазивный E. coli (EIEC).

Каждый из этих патотипов представляет собой группу клонов, которые обладают определенными факторами вирулентности. Тем не менее, следует отметить, что пластичность генома E. coli препятствовала идентификации определенных изолятов E. coli в качестве патотипа, поскольку некоторые изоляты сочетают в себе основные характеристики вирулентности различных патотипов и, таким образом, считаются потенциально потенциально опасными. более вирулентные гибридные патогенные штаммы.5

Описан еще один менее четко определенный патотип, а именно патотип E. coli (DAEC) с диффузной адгезией, который включает штаммы, которые прикрепляются к эпителиальным клеткам в диффузном распределении.6 Несмотря на их классификацию как группу В отличие от других патотипов, определение DAEC как другого патотипа DEC требует дальнейших эпидемиологических исследований, которым препятствовали трудности с его идентификацией и классификацией.5 Кроме того, некоторые E.coli , которые были классифицированы как адгезивный инвазивный патотип E. coli (AIEC), составляют один из потенциальных агентов болезни Крона (БК). БК — воспалительное заболевание кишечника (ВЗК), которое, как считается, вызывается комбинацией факторов (генетика, кишечная микробиота, факторы окружающей среды и кишечные патогены) .7, 8

Эпизоды диареи, вызванные инфекциями ДЭК, являются важными. проблема общественного здравоохранения среди детей и взрослых в развивающихся странах из-за их связи с заболеваемостью и смертностью детей в возрасте до пяти лет.Целью этого обзора было собрать информацию о текущих определениях, серотипах, происхождении, механизмах вирулентности, эпидемиологии и диагностике основных патотипов DEC с упором на исследования, проведенные в Бразилии.

Типичный и атипичный энтеропатогенный

E. coli

Термин энтеропатогенный E. coli (EPEC) впервые был использован в 1995 г. Neter et al., 9 для описания ряда штаммов E. coli , эпидемиологически связанных с серия вспышек детской диареи в 1940-х и 1950-х годах.10, 11 Первоначально идентифицированные по серотипу, EPEC теперь определяются как штаммы E. coli , обладающие способностью вызывать диарею, вызывать гистопатологию кишечного эпителия, известную как прикрепляющееся и стирающееся (AE) поражение, и неспособность к продуцируют токсины шига и термолабильные (LT) или термостабильные (ST) энтеротоксины.6

Усовершенствования методов, позволяющие лучше понять механизмы генома и вирулентности среди штаммов EPEC за последние годы, привели к подклассу EPEC на типичный EPEC (tEPEC) и атипичный EPEC (aEPEC).3, 12 Типичные штаммы EPEC, вызывающие инфекционную диарею человека, обладают большой плазмидой вирулентности, известной как плазмида фактора адгезии EPEC (EAF) (pEAF), которая кодирует фимбрии типа IV, называемые пучкообразующими пилусами (BFP), в то время как aEPEC не обладают эта плазмида.6, 12

Большинство штаммов tEPEC относятся к хорошо узнаваемым О-серотипам. Классические серогруппы EPEC O включают O55, O86, O111, O114, O119, O127 и O142. Наиболее распространенными антигенами H, связанными с EPEC, являются антигены H6 и h3.12, 13, 14, 15 Менее распространенным типом EPEC является h44, а ряд штаммов tEPEC классифицируются как неподвижные (H-) в обычных тестах. Сообщалось также о типичных штаммах EPEC, принадлежащих к неклассическим серотипам.12, 16

На основе анализа многофокусного ферментного электрофореза (MLEE) аллельных различий между генами домашнего хозяйства штаммы tEPEC были разделены на две основные линии, ранее обозначенные как EPEC1 и EPEC2. .13, 14 EPEC1 включает широко распространенные серотипы, такие как O55: H6 и O119: H6, тогда как EPEC2 состоит из серотипов с более ограниченным распространением, таких как O111: h3 и O114: h3.На основе полногеномной филогении и анализа эффекторов системы секреции типа III (T3SS) было продемонстрировано, что штаммы tEPEC объединяются в три основных клона, обозначенных EPEC1, EPEC2 и EPEC4, которые, вероятно, приобрели локус сглаживания энтероцитов (LEE). области и pEAF независимо.17

В свою очередь, aEPEC принадлежат к большому разнообразию классических и неклассических серотипов.12, 16, 18 Более 20% штаммов неклассических серотипов EPEC являются O-нетипируемыми, а O- Типовые штаммы принадлежат более чем 4200 различным серотипам, со многими неподвижными и нетипируемыми штаммами H.12, 18 Интересно, что было обнаружено, что 35% штаммов aEPEC также принадлежат к линиям tEPEC.17 Таким образом, была выдвинута гипотеза, что по крайней мере некоторые aEPEC могли происходить из штаммов tEPEC, которые потеряли pEAF в хозяине или в организме. environment.17, 19, 20

Факторы, механизмы и патогенез вирулентности

Типичные штаммы EPEC прикрепляются к HeLa, HEp-2 и другим клеточным линиям, а также к культурам органов in vitro в виде характерных трехмерных микроколоний, так называемый образец локализованной приверженности (ЛП).6, 21 Аналогичная картина приверженности наблюдалась при биопсиях тканей у людей, инфицированных EPEC.22

Фенотип LA опосредуется BFP, 23 который также способствует антигенности, аутоагрегации и образованию биопленок.23, 24, 25, 26, 27 Оперон из 14 генов, содержащихся в pEAF, необходим для экспрессии BFP, при этом bfpA кодирует основную структурную субъединицу (бандлин) 28 и является высококонсервативным среди штаммов EPEC1 и EPEC2.

Самопередающийся pEAF pMAR2 обнаружен среди штаммов линии EPEC1 и содержит интактную область переноса, в отличие от pB171, которая более распространена среди штаммов EPEC2.29, 30 Помимо кластера генов bfp , кодирующего BFP, 23 pEAF несет на локус , кодирующий активатор транскрипции, называемый плазмидно-кодируемым регулятором (Per) .29 Между pMAR2 и pB171, bfp и на каждый локусов имеют 99% сходства последовательностей 30, и было показано, что как BFP, так и PerA способствуют вирулентности у людей-добровольцев.24 Недавние сравнительные исследования геномики плазмид EAF из различных филогеномных линий EPEC продемонстрировали значительное разнообразие плазмид даже среди изолятов в пределах одной филогеномной линии. .31

Типичные EPEC обладают способностью образовывать плотные сферические аутоагрегаты бактерий при выращивании в жидкой культуре.32 Как и LA, для аутоагрегации требуется BFP. Типичные EPEC также образуют биопленки на абиотических поверхностях в статических условиях или в системе непрерывного культивирования, и была предложена модель образования биопленок EPEC.26 Анализ мутагенеза выявил адгезивные структуры, такие как общие ворсинки 1 типа (T1P), антиген 43, BFP и нить EspA (см. ниже) как участники бактериальной агрегации во время образования биопленки на абиотических поверхностях.26

Отличительным фенотипом как tEPEC, так и aEPEC является способность продуцировать AE-поражения.33 Этот фенотип характеризуется стиранием микроворсинок кишечных эпителиальных клеток и тесным сцеплением между бактерией и мембраной эпителиальных клеток. Непосредственно под прикрепленной бактерией наблюдаются заметные изменения цитоскелета в мембране эпителиальных клеток, в частности, формирование богатого актином чашеобразного пьедестала в месте контакта с бактериями. Поражения AE наблюдаются при модельных инфекциях EPEC с культивированными клетками и эксплантатами слизистой оболочки, а также в биоптатах кишечника у младенцев или животных, инфицированных EPEC.6

AE-поражения кодируются LEE, который представляет собой остров патогенности (PAI) размером около 35 т.п.н., который организован в пять оперонов (от LEE1 до LEE5) .35, 36, 37 Опероны LEE1, LEE2 и LEE3 кодируют компоненты T3SS и глобального регулятора Ler (регулятор, кодируемый LEE) .38 LEE4 кодирует секретируемые T3SS белки EspA, EspB и EspD (белок, секретируемый EPEC), которые являются компонентами аппарата транслокации, посредством которого другие эффекторные белки перемещается в клетку. LEE5 кодирует адгезин интимин и его транслоцированный рецептор Tir.39

Интимин представляет собой белок массой 94 кДа, кодируемый геном eae и необходимый для плотного прилипания ЕРЕС к клеткам-хозяевам в местах поражения АЕ.6 N-конец интимина высококонсервативен, тогда как С-конец очень вариабелен.40 Различия в С-конце интимина были использованы в качестве основы для классификации на несколько различных подтипов, представленных греческими буквами от α (альфа) до ζ (дзета) 41, 42; подтип α экспрессируется штаммами EPEC1, тогда как подтип β связан со штаммами EPEC2 человека.N-конец intimin закрепляет белок на внешней мембране EPEC, тогда как C-конец проходит от поверхности EPEC и связывается с Tir. Взаимодействие Intimin-Tir приводит к тесной адгезии и формированию пьедестала под прилипшими бактериями, 39 и ингибирует активность NF-κB через факторы, связанные с рецептором фактора некроза опухоли альфа (TNF-α) .43 Помимо Tir, геном EPEC содержит шесть других LEE. -кодированные эффекторные белки, которые перемещаются в клетку (Map, EspF, EspG, EspZ, EspH и EspB), которые влияют на различные аспекты физиологии клетки.13, 36, 37, 44

Помимо эффекторов LEE, различные эффекторные гены, не кодируемые LEE (Nle) ( cif , espI / nleA , nleB , nleC , nleD , nleE , nleH ) 36, 44, которые расположены вне области EPEC LEE, по крайней мере, в шести хромосомных PAI или в профаговых элементах.45, 46 Было показано, что белки Nle разрушают цитоскелет и плотные соединения клетки-хозяина, а также для модуляции или предотвращения воспалительной реакции хозяина.45, 46, 47 Хотя они не требуются для образования поражений AE, понятно, что они способствуют увеличению бактериальной вирулентности.44

Внутриклеточные tEPEC наблюдались как в культуре ткани, так и в биопсиях тонкого кишечника от инфицированного EPEC младенца. 6 В двух исследованиях сообщалось, что штаммы O111: NM содержат плазмидные последовательности, которые придают инвазивность штаммам E. coli K12, содержащим клонированные фрагменты.48, 49 Последовательности, гомологичные этим клонированным генам, присутствуют только в меньшинстве штаммов tEPEC (Scaletsky et al. al., неопубликованные данные).

Типичные штаммы EPEC кодируют белок с большой поверхностью, фактор ингибирования лимфоцитов (LifA), который подавляет экспрессию нескольких лимфокинов и ингибирует пролиферацию лимфоцитов.50 Два родственных гена efa1 и toxB участвуют в адгезии к эпителиальным клеткам. 51, 52 Имеются данные, указывающие на то, что Efa1 / LifA способствует адгезии эпителиальных клеток in vitro 53 и необходим для колонизации кишечника мышей родственным патогеном AE Citrobacter rodentium .54

Некоторые штаммы tEPEC помимо BFP обладают другими фимбриями или пилями. Фимбрии типа 1 EPEC были признаны антигенными в исследованиях на добровольцах; однако они не играют роли в прикреплении к эпителиальным клеткам in vitro .6 Кроме того, некоторые штаммы EPEC имеют консервативные фимбриальные гены, кодирующие гомологи длинных полярных фимбрий (LPF) 55, но ряд полиморфизмов в пределах lpfA гены были идентифицированы.56 Первоначальные исследования показали, что LPF, по-видимому, не является необходимым для приверженности и поражения НЯ в биоптатах человека.55 Общая пилус (ECP) E. coli также действует как дополнительный фактор прикрепления в EPEC, играя роль во время клеточной адгезии и / или во взаимодействии бактерий и бактерий.57 Однако значение ECP для EPEC патогенез не установлен. Интересно, что было показано, что некоторые штаммы tEPEC могут продуцировать фенотип гибридной адгезии в клетках HeLa, , т.е. , LA и агрегативный (AA) -подобный паттерн одновременно (LA + / AA-подобный +) .58 Недавно было показано, что по крайней мере, некоторые из этих LA / AA-подобных + штаммов несут большие плазмиды, отличные от pEAF, которые кодируют пока неизвестный адгезин.59 Было высказано предположение, что способность таких штаммов одновременно продуцировать поражения АЕ и ассоциированную с АА биопленку может ухудшить клиническое состояние пациента, что приведет к стойкой диарее.59

Жгутики также могут участвовать в прикреплении tEPEC к эпителиальным клеткам, 60 поскольку у некоторых мутантов EPEC заметно нарушена их способность прикрепляться и образовывать микроколонии. Кроме того, в одном исследовании очищенные жгутики EPEC и антитела против жгутиков были эффективны в блокировании присоединения нескольких серотипов EPEC.60 Однако другое исследование не смогло подтвердить роль жгутиков в приверженности EPEC.61

Некоторые штаммы tEPEC несут ген astA , который кодирует энтероагрегант E.coli , термостабильный энтеротоксин 1 (EAST1) .62, 63 Недавнее исследование показало, что 11 из 70 (16%) протестированных штаммов tEPEC содержали интактный ген astA .64 Типичные штаммы EPEC серотипа O86: h44 продуцируют токсин, расширяющий цито летальный исход (CDT) .65 Значение токсинов EAST1 и CDT в Патогенез EPEC остается неизвестным.

Автотранспортные белки (AT), которые были связаны с бактериальной адгезией, агрегацией, образованием биопленок, инвазией и токсичностью66 у грамотрицательных бактерий, также были описаны среди штаммов EPEC.67 Один такой белок, EspC, который секретируется система секреции типа V и вводится T3SS в эпителиальные клетки, обладает активностью, подобной протеазе IgA, и, попав в цитоплазму хозяина, оказывает различные цитопатические эффекты, включая повреждение цитоскелета, 68 повышенную резистентность к лизоциму, 70 деградацию гемоглобина, 69 гидролиз пепсина, фактора V и спектрина 70, а также фодрина и фокальной адгезии деградации белка.71 Кроме того, олигомеризация EspC приводит к образованию веревкообразных структур, которые служат субстратом для адгезии и образования биопленок, а также защищают бактерии от антимикробных соединений.72

Трехэтапная модель адгезии и патогенеза tEPEC, состоящая из LA , сигнальная трансдукция и тесное прикрепление с образованием пьедестала было предложено.73 Одновременно с интимным прикреплением ряд бактериальных эффекторных белков вводится в клетки-хозяева, где они нарушают полимеризацию актина и другие процессы в клетке-хозяине.37, 44 На самой ранней стадии и при правильных условиях окружающей среды tEPEC экспрессируют BFP, intimin и аппарат T3SS / translocon. Затем EPEC прикрепляются к поверхности кишечного эпителия через волокна BFP и EspA, а T3SS вводит бактериальный транслоцированный рецептор интимина (Tir) и эффекторные белки (EspB, EspD, EspF, EspG и Map) непосредственно в хозяина. cell.37 Эффекторы активируют сигнальные пути клетки, вызывая изменения в цитоскелете клетки-хозяина и приводя к деполимеризации актина и потере микроворсинок.Наконец, бактерии тесно прикрепляются к клетке-хозяину за счет взаимодействий intimin-Tir, вызывая перестройку цитоскелета, которая приводит к образованию структур, подобных пьедесталу. Tir способствует реорганизации цитоскелета за счет взаимодействия с нейральным WASP (белок синдрома Вискотта-Олдрича) (N-WASP) и последующей активации комплекса Arp2 / 3, 45 приводя к стиранию микроворсинок и образованию пьедесталов. эффекторы нарушают процессы в клетке-хозяине, что приводит к потере целостности плотных контактов и митохондриальной функции, что приводит как к потере электролитов, так и к возможной гибели клеток.45

Для подрыва динамики актина tEPEC обычно рекрутирует Nck в сайт адгезии в Tir-фосфорилированном Y474-зависимом механизме. В свою очередь, Tir EHEC (энтерогеморрагический E. coli [EHEC] O157: H7) лишен эквивалента Y474 и использует EspF U / TccP (связывающий белок Tir-цитоскелет), транслоцированный T3SS эффекторный белок, который связывает N-WASP, что приводит к Nck-независимой полимеризации актина.45

aEPEC лишены pEAF и не продуцируют BFP.Важно отметить, что штаммы EPEC серотипов O128: h3 и O119: h3 содержат pEAF с дефектными оперонами bfp , которые содержат часть гена bfpA , но имеют удаленную остальную часть кластера генов bfp . Таким образом, они классифицируются как aEPEC.12, 75 Большинство aEPEC создают паттерны приверженности, классифицируемые как LA-подобные, с более рыхлыми микроколониями по сравнению с микроколониями паттерна tEPEC LA.12, 76, 77 Кроме того, некоторые изоляты экспрессируют агрегат (AA). или диффузные (DA) модели приверженности, которые являются характеристиками патотипов EAEC и DAEC, соответственно, 20, 78, либо придерживаются неопределенных моделей, либо не придерживаются.20, 78, 79, 80 Примечательно, что фенотип адгезии эпителиальных клеток, демонстрируемый aEPEC, определяется в длительных анализах (6 часов) взаимодействия бактерий с клетками.12, 76, 77 Кроме того, было высказано предположение, что отсутствие pEAF- Белки, кодируемые Per в регуляторном каскаде генов вирулентности aEPEC, могут способствовать замедленному формированию повреждений AE, что, вероятно, затрудняет для таких штаммов возможность вызвать заболевание.81

Распространенность подтипов интимина среди штаммов aEPEC была рассмотрена.18, 67 Классифицированы интимины. как beta1, epsilon1 и theta встречаются как наиболее часто встречающиеся среди aEPEC.78, 82, 83, 84, 85 Кроме того, некоторые штаммы aEPEC несут гены, кодирующие адгезив, которые были первоначально описаны для других патотипов DEC и / или внекишечных патогенных E. coli .79, 80, 82, 86, 87 , 88 Это наблюдение предполагает, что aEPEC может использовать дополнительные механизмы приверженности помимо взаимодействия Tir-intimin. Единственный адгезин, впервые охарактеризованный в штамме aEPEC (серотип O26: h21), — это локус диффузной адгезии (LDA), который представляет собой афимбриальный адгезин, придающий диффузный характер адгезии клеткам HEp-2 при клонировании в E .coli K-12.89 Было также показано, что транслокон T3SS вносит свой вклад в эффективность адгезии штамма aEPEC in vitro .90 Распространенность этих различных адгезинов среди aEPEC недавно была рассмотрена18, 67, 91

Более того, недавно было показано, что белок жгутиковой крышки FliD штамма aEPEC (серотип O51: h50) связывается с неизвестными рецепторами на микроворсинках кишечных клеток Caco-2.92 Интересно, что сыворотка против FliD и очищенный FliD снижают адгезию. aEPEC, а также прототипных штаммов tEPEC, EHEC и ETEC в одной и той же клеточной линии.92 Кроме того, было высказано предположение, что присоединение aEPEC серотипа O26: h21 может быть опосредовано связыванием белка флагеллина FliC (субъединица стержня жгутика) с клеточным фибронектином. 93 Однако роль жгутиков в aEPEC в vivo колонизация еще не исследована.

Было также показано, что атипичные штаммы EPEC прилипают к абиотическим поверхностям (полистирол и стекло) .94, 95 Было показано, что нефимбриальный адгезин curli и T1P опосредуют связывание с этими поверхностями в некоторых aEPEC при различных температурах.90, 96

Область LEE некоторых штаммов aEPEC обнаруживает генетическую организацию, аналогичную той, которая обнаружена в штамме прототипа tEPEC E2348 / 69.97 Хотя гены, кодирующие T3SS, в значительной степени консервативны, 97, 98 гены, кодирующие эффекторный белок, демонстрируют важные различия, и заметные различия могут быть обнаружены в 5′- и 3′-фланкирующих областях aEPEC, что позволяет предположить наличие различных эволюционных событий.99 Атипичные штаммы EPEC могут нести два варианта tccP , tccP и / или tccP2 , предполагая, что некоторые штаммы aEPEC могут использовать пути как Tir-Nck, так и Tir-TccP, чтобы способствовать полимеризации актина.100 Интересно, что Rocha и соавторы101 показали, что трансформация неприлипающего штамма aEPEC (серотип O88: HNM) плазмидой, экспрессирующей TccP, наделяет этот штамм способностью прикрепляться к клеткам HeLa и индуцировать их накопление.

Возникновение и распространенность Nle в штаммах aEPEC были недавно рассмотрены.67 Было высказано предположение, что разные изоляты могут использовать разные стратегии для содействия повреждению хозяина и вызвать заболевание.45 Кроме того, эффекторы Nle Ibe (инвазия эндотелия) клетки) и EspT были первоначально описаны и охарактеризованы в штаммах aEPEC.102, 103 Ibe, по-видимому, регулирует фосфорилирование Tir и усиливает полимеризацию актина и образование пьедестала, 103 в то время как EspT104 модулирует динамику актина, приводя к взъерошению мембран и клеточной инвазии, и побуждает макрофаги продуцировать интерлейкины IL-8, IL-1β и PGE2. 102

Инвазия эпителиальных клеток in vitro по интимин-зависимому пути была описана в штамме aEPEC, 105 но дальнейшие исследования показали, что инвазивный фенотип не является общей характеристикой среди aEPEC.106 Несмотря на их инвазивный потенциал in vitro , 107 большинство aEPEC считаются внеклеточными патогенами.5

Было показано, что апикальная инфекция культивируемых кишечных клеток HT29-MTX, секретирующих человеческий муцин, некоторыми штаммами aEPEC может вызывать повышенную продукцию секретируемого MUC2. и муцины MUC5AC и связанные с мембраной муцины MUC3 и MUC4.108 Это наблюдение предполагает, что апикально прикрепляющиеся бактерии могут использовать большие количества муцинов для более эффективного роста в кишечнике хозяина, что характеризует предполагаемый новый механизм вирулентности в aEPEC.108

Было также показано, что белки

AT продуцируются некоторыми штаммами aEPEC.67 Abreu и коллеги109 показали, что белок AT, кодируемый геном ehaC , который участвует в образовании биопленок у штаммов EHEC, был наиболее частым, со значительно большей распространенностью, чем в tEPEC. Хотя преобладание AT-белка Pic (белка, участвующего в колонизации кишечника), ранее идентифицированного в EAEC, не является обычным явлением для штаммов aEPEC, он также, по-видимому, опосредует колонизацию кишечника мышей, гемагглютинацию, расщепление муцина и деградацию компонентов комплемента.110 Совсем недавно было показано, что некоторые штаммы aEPEC вызывают повреждение клеток, секретируя AT-белок Pet (токсин, кодируемый плазмидой) во внеклеточную среду.111

Эпидемиология

Распространенность инфекций EPEC варьируется между эпидемиологическими исследованиями на основе различий в исследуют популяции, возрастное распределение и методы (серотипирование, схемы приверженности и наличие eae или консервативных генов LEE), используемые для обнаружения и диагностики.112 Кроме того, различия в географических регионах, периодах времени и социально-экономическом классе также могут способствовать различия в эпидемиологии диарейного заболевания, вызванного EPEC.113 Отсутствие различий между tEPEC и aEPEC в некоторых исследованиях также затрудняет такой анализ.

Диарея, вызванная tEPEC, уменьшается с возрастом, а инфекции у взрослых регистрируются редко. Эта очевидная резистентность у взрослых и детей старшего возраста объясняется потерей специфических рецепторов с возрастом или развитием иммунитета.6

На протяжении многих десятилетий исследования, проводимые во всем мире, показали, что серотипы tEPEC тесно связаны с диареей у детей младше 1 года. возраст, в основном у бедных детей в городских центрах.6, 12, 15 Связь с диареей была особенно сильной у детей младше 6 месяцев. Исследования, проведенные в Бразилии, Чили, Мексике и Южной Африке, показали, что 30–40% случаев детской диареи были вызваны серотипами tEPEC.15, 112, 114 Однако эпидемиология инфекций EPEC изменилась. Во многих развивающихся странах, где распространенность инфекции EPEC была высокой до 1990-х годов, недавние исследования не выявили значительной связи между tEPEC и детской диареей.В Бразилии 92% изолятов EPEC, собранных у детей в период с 2001 по 2002 год, были атипичными, 115 по сравнению с 38% в исследовании 1998–1999 годов.79 Однако в других исследованиях все еще сообщается, что tEPEC более распространен, чем aEPEC, как причина диареи116. Кроме того, в некоторых менее развитых регионах (Африка и Азия) tEPEC по-прежнему являются одними из самых важных энтеропатогенов.117, 118, 119, 120, 121, 122 На основе недавно завершенного Глобального многоцентрового исследования кишечника (GEMS) с участием детей в меньшей степени. в возрасте более 5 лет из семи пунктов в Африке и Азии, tEPEC в значительной степени ассоциировался с умеренной и тяжелой диареей у детей в возрасте до 2 лет в Кении, тогда как aEPEC не был связан с этим типом диареи.118

Передача tEPEC происходит фекально-оральным путем через загрязненные поверхности, жидкости для отлучения от груди и людей-носителей.123 Вспышки среди взрослых, хотя и редки, по всей видимости, происходят в результате приема зараженной пищи и воды; однако не было выявлено никакого конкретного резервуара окружающей среды6. Инфекционная доза у взрослых добровольцев высока, от 10 8 до 10 10 организмов, 124 в то время как инфекционная доза, вызывающая заболевание у детей, неизвестна. Сообщается, что вспышки EPEC имеют сезонное распределение с пиками в теплые месяцы.6, 125 Люди являются единственным известным резервуаром для tEPEC, наиболее вероятным источником которых являются дети с симптомами и бессимптомно, а также бессимптомные взрослые.6

В отличие от tEPEC, aEPEC были обнаружены у пациентов с диареей всех возрастов и у взрослых с ВИЧ-инфекцией. СПИД.82, 126, 127, 128 Кроме того, увеличилась доля штаммов aEPEC, а количество штаммов aEPEC превзошло количество штаммов tEPEC, а также они были связаны с детской диареей в некоторых развивающихся и развитых странах.12, 18, 67, 91, 112 , 129 Однако увеличение распространенности aEPEC может также отражать четкое различие между tEPEC и aEPEC.12, 18, 91

Роль aEPEC при диарее не ясна из-за того, что частота его обнаружения одинакова как у диареи, так и у пациентов без диареи в различных географических регионах. 18, 91, 128 В исследованиях, проведенных за последние пять лет, Частота aEPEC варьируется от ~ 0,05 до ~ 12% у пациентов с диареей против от 0 до ~ 14% у пациентов, не страдающих диареей.67 Некоторые недавние исследования также указывают на то, что aEPEC является причиной стойкой и кровавой диареи.18, 91 Более того, штаммы aEPEC были связаны со вспышками диареи в Финляндии, США, Японии, Китае18, 91, 112 и Бразилии.85

В отличие от tEPEC, которые редко встречаются у животных, 12 многие штаммы aEPEC были обнаружены как у диарейных, так и у здоровых животных.18, 67 Интересно, что были идентифицированы серогруппы aEPEC животных, связанные с диареей человека ( например, , O26 , O103, O119, O128, O142 и O157) .18, 130, 131 Серотипирование и молекулярные методы, такие как мультилокусное типирование последовательностей (MSLT) и гель-электрофорез в импульсном поле (PFGE), способствовали демонстрации того, что домашние и дикие животные и окружающая среда являются потенциальные источники aEPEC для инфекций человека в нескольких регионах.18, 67, 91, 131 Таким образом, хотя до сих пор не было показано прямой передачи вируса от животных человеку, разумно предположить, что некоторые штаммы aEPEC являются потенциально зоонозными патогенами, при этом большое количество видов животных служат важными резервуарами 67. , 91 Кроме того, пищевые продукты, включая сырое мясо, пастеризованное молоко, овощи и воду, также участвуют в качестве носителей aEPEC в человеческих инфекциях.67

Штаммы aEPEC составляют очень разнообразную группу с различными дополнительными механизмами вирулентности, которые в совокупности могут модулировать исход болезни или их появление у бессимптомных лиц.Мы постоянно совершенствуем наши знания о генетическом фоне и патогенности aEPEC, а также информацию, полученную в результате эпидемиологических исследований, и это может способствовать различению штаммов, вызывающих диарею, и штаммов, вызывающих бессимптомные инфекции.

Обнаружение и диагностика

EPEC может быть обнаружен с помощью ДНК-зондов или ПЦР с использованием праймеров, нацеленных на гены eae, и stx .132, 133 Все eae -положительные и stx -отрицательные E.coli дополнительно тестируют с помощью ПЦР на наличие гена bfpA , кодирующего bundlin6 и / или плазмиду EAF, для дифференциации tEPEC от aEPEC.134, 135 Однако это может не идентифицировать все bfpA -положительные штаммы EPEC, поскольку были идентифицированы множественные аллели bfpA , 136 можно предположить, что некоторые современные методы ПЦР могут не идентифицировать все bfpA -положительные штаммы EPEC.

Однако в обычных микробиологических лабораториях все E.coli , полученные из планшетов для первичной изоляции, традиционно подвергают скринингу с помощью тестов агглютинации на предметных стеклах с использованием сывороток против классических серогрупп EPEC O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142 и O158.137. практична и проста в исполнении, главным преимуществом которой является коммерческая доступность сывороток. Однако недостатком этого метода является гетерогенность серогрупп EPEC, которые могут включать категории, отличные от EPEC, невозможность отличить tEPEC от aEPEC в пределах этих серогрупп, а также наличие штаммов EPEC, принадлежащих к серогруппам, отличным от классических серогрупп EPEC.12, 18, 138, 139

Поскольку штаммы EPEC определяются на основе их свойств вирулентности, набор белков, включая секретируемые intimin, BFP и T3SS белки, можно рассматривать как мишени для диагностики. Экспрессия BFP считалась фенотипическим маркером tEPEC.18, 78, 140 Были использованы тесты иммунофлуоресценции и иммуноблоттинга с использованием моноклональных или поликлональных антител против BFP.141, 142 Эти цитируемые авторы обнаружили продукцию BFP в различных средах, в которых они сообщили что 91% испытанных штаммов tEPEC продуцировали BFP в среде Игла, модифицированной Дульбекко (DMEM), 89% — в агаре MacConkey и 83% — в агаре EMB.Эти результаты особенно интересны, поскольку агары MacConkey и EMB обычно используются для идентификации ферментирующих лактозу E. coli , выделенных из диарейного стула. Иммуноблоттинг колоний для обнаружения tEPEC на основе экспрессии BFP также был стандартизирован с использованием кроличьей поликлональной сыворотки tEPEC против BFP. Стандартизацию проводили после выращивания бактериальных изолятов на агаре DMEM, содержащем фетальную бычью сыворотку, или триптическом соевом агаре, содержащем 5% промытой овечьей крови (TSAB). Этот тест показал положительность 92 и 83% и специфичность 96 и 97% соответственно, когда культивирование проводили в DMEM и TSAB.Этот метод сочетает в себе простоту иммуносерологического анализа с высокой эффективностью тестирования большого количества колоний EPEC.140

Что касается обнаружения интимина, то использовали поликлональные кроличьи сыворотки, полученные против консервативной области интимина (Int388-667) 143, для того, чтобы Для обнаружения изолятов tEPEC, экспрессирующих α, β, γ, δ и ɛ intimin, сообщалось о применении иммуноблоттинга со 100% специфичностью и 97% чувствительностью при обнаружении eae положительных штаммов E. coli .144, 145, 146 Эти авторы ясно продемонстрировали, что поликлональные кроличьи антисыворотки подходят для иммуноблоттинга в качестве диагностического инструмента, и показали, что денатурация и линеаризация белка являются критическим шагом для доступности антиинтиминовых антител. Действительно, даже при использовании рекомбинантного антитела, такого как вариабельный одноцепочечный фрагмент (scFv-интимин), 147, 148, просто путем иммунофлуоресценции, scFv-интимин смог обнаружить изоляты tEPEC, aEPEC и EHEC, что показывает, что интимин может быть мишенью для EPEC и диагностика EHEC после бактериальной проницаемости.148

Что касается секретируемых белков, Лу и др. 149 разработали новый практический метод идентификации EPEC путем обнаружения секретируемого белка B E. coli (EspB) в культуральном супернатанте путем обратной пассивной латексной агглютинации (RPLA) после штаммов. выращивались в среде DMEM. Кроме того, Nakasone et al., 150 разработали экспресс-иммунохроматографический (IC) тест для определения присутствия EspB в изолятах EPEC и EHEC. Сообщается, что предел обнаружения теста составляет 4 нг / мл, а результаты показали 96.9% чувствительность и 100% специфичность. Тест IC для обнаружения EspB может быть практическим методом определения EPEC или EHEC как в клинических лабораториях, так и в полевых условиях.150

Кроме того, был стандартизирован тест быстрой агглютинации с использованием латексных шариков, покрытых анти-EspB mAb, показав 97 % чувствительности, 98% специфичности и 97% эффективности, что необходимо для диагностики энтеропатогенных заболеваний и может использоваться в развивающихся странах с плохо оборудованными лабораториями.151

Энтерогеморрагический (продуцирующий токсин шига)

E.coli (EHEC / STEC)

EHEC / STEC представляют собой хорошо известную группу патогенов пищевого происхождения, распространенных во всем мире. Способность продуцировать один или несколько цитотоксинов семейства шига-токсинов (Stx )152 составляет основной признак вирулентности этой патогруппы E. coli . EHEC / STEC вызывает широкий спектр инфекций, от легкой и почти незаметной диареи до более серьезных проявлений, таких как геморрагический колит (ГК) и развитие опасного для жизни синдрома, известного как гемолитико-уремический синдром (ГУС).Младенцы и дети являются основными больными, и, хотя частота инфицирования варьируется в разных регионах, влияние и важность инфекций EHEC / STEC для общественного здравоохранения огромны, поскольку они являются основной причиной острой почечной недостаточности у детей во многих странах. Перспектива инфекций EHEC / STEC была описана ранее, 153, 154, но в последние годы был получен значительный объем информации, связанной с эпидемиологией, экологией и свойствами вирулентности этих бактерий.

E. coli O157: серотип H7 был первым, который был связан с случаями HC и HUS в начале 1980-х годов, и с тех пор он несет ответственность за многочисленные вспышки и спорадические случаи тяжелых заболеваний во всем мире, поэтому считается быть прототипом этой патогенной группы бактерий.155 Хорошо известно, что сотни других серотипов E. coli могут содержать гены stx , но эпидемиологические исследования, проведенные во всем мире, доказали, что только некоторые из них ответственны за вызывая болезни человека.Некоторые серогруппы, включая O26, O45, O103, O111, O121 и O145, могут быть выделены среди серогрупп, наиболее часто связанных с инфекциями человека.156 Более того, в последние годы появились некоторые конкретные клоны, такие как гибрид O104: h5 энтероагрегант E. coli. , несущие гены Stx2, ответственные за серьезную вспышку ГУС, начавшуюся в Германии в 2011 г., 157 распространение нового клона O26: h21 в Европе, 158 и некоторых других гибридных клонов, 159 предполагает, что подвижность генов и, конечно, фон хозяина являются важными особенностями, влияющими на их патогенный потенциал.

Факторы, механизмы и патогенез вирулентности

Общей чертой изолятов EHEC / STEC является способность продуцировать Stx. Это семейство токсинов имеет консервативную структуру субъединицы AB 5 , состоящую из одной активной субъединицы A, связанной с пентамерной субъединицей B, ответственной за связывание токсина со специфическими гликолипидными рецепторами на поверхности клеток-мишеней. Оперон stx обычно находится в последовательности индуцибельного лизогенного лямбда-подобного бактериофага.Stx ингибируют синтез белка, удаляя остаток аденина из 28S рРНК 60S рибосомы.152 Однако, помимо этой активности, исследования показали, что Stx также действует на трансдукцию клеточного сигнала и иммунную модуляцию, вызывая провоспалительный и проапоптотический ответы159. семейства Stx1 и Stx2 были распознаны, и на основе разнообразия последовательностей каждое состоит из нескольких вариантов. Семейство Stx1 более однородно и включает Stx1a, Stx1c и Stx1d; в то время как гетерогенная группа Stx2 состоит из Stx2a, Stx2b, Stx2c, Stx2d, Stx2e, Stx2f и Stx2g.160 Следует отметить, что связь некоторых вариантов, таких как Stx2a, Stx2c или Stx2d, с HC и HUS была подчеркнута по сравнению с некоторыми другими, которые, как представляется, были более связаны с неосложненными случаями диареи, такими как варианты Stx1 или даже Stx2e, Stx2f и Stx2g. , которые до сих пор редко вызывают инфекции у людей.161, 162 В самом деле, более высокая ассоциация Stx2 с тяжелыми заболеваниями широко изучалась с использованием Vero и линий эндотелиальных клеток, а также некоторых моделей на животных.159 Более того, знание характеристик и поведения фага stx помогло нам понять, каким образом различия в экспрессии Stx между изолятами EHEC / STEC могут способствовать патогенезу и заболеванию. 163

Еще одним ключевым событием является способность прикрепляться к эпителиальным клеткам кишечника. в патогенезе EHEC / STEC. Присутствие острова хромосомной патогенности LEE, 164, также присутствующего в изолятах, принадлежащих к патотипу EPEC, является обычным явлением. Хотя LEE был описан среди основных серотипов EHEC / STEC, ответственных за высокую долю случаев HC и HUS в нескольких странах, его присутствие не является обязательным условием для возникновения более серьезных инфекций, как первоначально предполагалось, поскольку некоторые LEE-отрицательные штаммы также могут вызывать вспышки и спорадические случаи ГУС.165, 166

Таким образом, очевидно, что патогенез EHEC / STEC представляет собой многоступенчатый процесс, и, помимо продукции токсинов Stx и поражения AE, были описаны и обнаружены другие факторы, включая различные типы токсинов и адгезинов. вирулентность.159

Следует также учитывать, что в качестве патогена желудочно-кишечного тракта человека способность EHEC / STEC контролировать питательные вещества в кишечной среде и транслировать эту информацию для определения физиологического состояния хозяина, чтобы запрограммировать выражение его Маркеры вирулентности играют ключевую роль в развитии инфекции.167 Кроме того, было показано, что EHEC / STEC также может перекрестно связываться с хозяином, используя сигнальную систему аутоиндуктора-3 (AI-3) / адреналина / норадреналина для выражения двух важных признаков вирулентности, подвижности и поражения A / E. , необходимые в разные моменты времени во время кишечной колонизации.168

Способность прилипать, колонизировать и образовывать биопленку на продуктах питания и на нескольких типах поверхностей может быть важным источником и / или средством передачи EHEC / STEC. Кроме того, биопленка может также действовать как бактериальная защита от неблагоприятных условий окружающей среды.В исследовании, проведенном Biscola et al., 169, оценивалась способность образовывать биопленку у штаммов EHEC / STEC, выделенных из различных резервуаров и серотипов. Авторы заметили, что способность прилипать к абиотическим поверхностям, образующим биопленки, при определенных условиях культивирования проявляется у ряда штаммов O157 и не-O157 дикого типа. Производство биопленок было идентифицировано в нескольких серотипах STEC, не относящихся к O157, человеческого, животного и пищевого происхождения. С другой стороны, среди штаммов O157 только те, которые были выделены из резервуара для животных и из пробы воды, образовывали биопленку.Тесная корреляция между образованием биопленок и экспрессией curli fimbriae и целлюлозы наблюдалась среди штаммов O157. Однако, помимо curli, наличие других факторов, таких как фимбрии типа 1 и белки AT, может быть связано со способностью образовывать биопленку у штаммов, отличных от O157. Matheus-Guimarães et al., 170 изучили штаммы O157 и не-O157 EHEC / STEC, выделенные из шкур и туш крупного рогатого скота, и показали, что различные наборы генов участвуют во взаимодействиях бактерий с биотическими и абиотическими поверхностями.Более того, обнаружение штамма O157, который был способен образовывать биопленку как на стекле, так и на полистироле, прилипал к человеческим клеткам и вторгался в них, предполагает важную способность этого изолята сохраняться в окружающей среде и взаимодействовать с хозяином. Фактически, клеточная инвазия и выживаемость некоторых штаммов EHEC / STEC в культивируемых эпителиальных клетках кишечника человека были описаны ранее.171 Следует отметить, что эта инвазивная характеристика была идентифицирована у некоторых серотипов EHEC / STEC, многие из которых ответственны за человеческий инфекции.170, 171, 172, 173 Следовательно, вполне вероятно, что эта стратегия вирулентности может помочь бактериям преодолеть защитные механизмы хозяина и, безусловно, способствует их сохранению в зоонозном резервуаре, обеспечивая эффективную передачу в окружающей среде и с пищей.

Другой интересной темой был анализ и сравнение профиля вирулентности штаммов EHEC / STEC, выделенных из резервуара для животных и окружающей среды, со штаммами, полученными после инфекций человека. В целом эти исследования показали, что, несмотря на разнообразие серотипов, подтипы stx и профиль вирулентности, идентифицированный среди изолятов из резервуара животных и окружающей среды, аналогичны изолятам, полученным от пациентов.173, 178, 179, 180 Особый интерес вызывают некоторые серотипы STEC, которые вызывают тяжелые инфекции у человека, такие как O113: h31, но, в отличие от других, они не продуцируют адгезины, кодируемые LEE. С помощью микроматрицы ПЦР был протестирован 41 вирулентный или генетический маркер на панели из 65 штаммов O113: h31, выделенных из клинических инфекций, окружающей среды и пищевых продуктов из разных стран.174 Полученные результаты не показали четких различий в этих генетических маркерах между выделенными патогенами. от случаев ГУС и штаммов окружающей среды.Более того, во всех изолятах было идентифицировано только подтипа stx , ассоциированных с инфекциями человека, что позволяет предположить, что изоляты из окружающей среды могут вызывать заболевания человека.

Эпидемиология

Частота случаев ГУС в Бразилии низкая, 175 и хотя была предложена некоторая гипотеза для объяснения этого факта, данные об иммунном ответе против Stx ограничены. В попытке преодолеть этот пробел недавно была определена распространенность антител против Stx2 в сыворотках детей с диагнозом ГУС и здоровых детей.176 Процент людей, показывающих антитела против Stx2, был выше среди пациентов с HUS, чем в контрольной группе, и результаты также подтвердили, что штаммы STEC циркулируют в наших условиях, несмотря на небольшое количество выявленных случаев HUS.

Среди нескольких серотипов, связанных с инфекциями человека, O157: H7 отвечает за более тяжелые случаи. Эпидемиологические исследования вспышек диареи, проведенные в четырех штатах Бразилии, показали, что штаммы O157: H7 были выделены у двух госпитализированных пациентов, у одного с ГУС, а у другого с кровавой диареей.177 Кроме того, были идентифицированы штаммы O157: H7, EHEC / STEC, принадлежащие к шести наиболее важным серогруппам, не относящимся к O157, таким как O26, O103, O111 и O145, все из которых были получены от амбулаторных пациентов. Кроме того, были обнаружены некоторые необычные серогруппы, в том числе O1, O24 и O77, но все они были связаны с острой диареей. Интересно отметить, что большинство пациентов, у которых был выделен STEC, были женщинами (57%), а возраст пациентов варьировался от 8 месяцев до 80 лет, при этом большинству было меньше пяти лет (54%).177

Распределение EHEC / STEC в желудочно-кишечном тракте большого количества животных указывает на зоонозный характер его инфекций. Роль различных видов животных как бессимптомных переносчиков EHEC / STEC в последние годы широко изучалась в Бразилии. Помимо крупного рогатого скота, который является их наиболее распространенным естественным резервуаром, 173, 178 присутствие этих патогенов было обнаружено в фекалиях молочных буйволов, 179 овец, 180, 181 свиньи, 182, 183 птиц, 184 и рыб.185 Это примечательно. что некоторые соответствующие серотипы, связанные с инфекциями человека, такие как O103: h3 и O157: H7, были извлечены из фекалий овец186 и крупного рогатого скота173 соответственно.Кроме того, высокая распространенность штаммов O157: H7 EHEC / STEC, выявленных в шкурах крупного рогатого скота, отправленных на убой на бразильском перерабатывающем заводе178, безусловно, представляет собой актуальную проблему, которую следует учитывать при рассмотрении мероприятий, направленных на EHEC / STEC, связанных с обращением с животными на ферме. на убой, а также обеспечение безопасности пищевых продуктов на всех этапах производства и переработки.

Присутствие EHEC / STEC в окружающей среде — еще одна проблема, вызывающая беспокойство, поскольку они могут выжить в почве, навозе, пастбищах и воде, которые, таким образом, представляют собой важные средства передачи.Выделение штаммов STEC из источников питьевой воды, собранных в различных муниципалитетах на севере штата Парана, было недавно описано, что подчеркивает важность питьевой воды, особенно из неочищенной воды, как источника штаммов STEC, потенциально патогенных для человека187. Принимая во внимание, что куриный помет очень полезен в качестве органического удобрения почвы для производства фруктов и овощей в наших условиях, обнаружение STEC в органических удобрениях для кур, используемых на фермах188, также представляет значительную опасность для здоровья населения.

Хотя данных об обнаружении EHEC / STEC в пищевых продуктах в Бразилии все еще мало, выделение и идентификация серотипа O157: H7 в образце говяжьего фарша были описаны впервые, 189 в то время как O125: h29 и O149: H8 STEC серотипы были обнаружены в охлажденных сырых киббе, собранных в торговых точках.190 С другой стороны, EHEC / STEC не был обнаружен в образцах пастеризованного коровьего молока, собранных на молочных заводах в северо-западном штате Парана191, или в сыром молоке, пастеризованном молоке, сыре Minas Frescal и молотом образцы говядины, собранные в штате Минас-Жерайс.192 Следует знать, что, несмотря на трудности с обнаружением и выделением EHEC / STEC из пищевых продуктов, внедрение наиболее чувствительных методов в большинстве лабораторий должно стать основной целью в ближайшем будущем, чтобы помочь в анализе риска, связанного с пищевыми продуктами. как средства передачи СТЭК человеку.

Обнаружение и диагностика

Важная проблема заключается в том, как обнаружить штаммы, продуцирующие токсин шига, в стуле инфицированных пациентов или в зараженной пище, поскольку необходимо избирательное обогащение.193, 194 Для рутинной диагностики уже описаны некоторые протоколы.139 Однако золотым стандартом для обнаружения Stx по-прежнему является оценка цитотоксичности супернатантов бактериальных культур по отношению к эукариотическим клеткам. 195, 196 Таким образом, мультиплексная ПЦР, включающая stx ген. и другие гены вирулентности могут быть полезны при скрининге STEC с использованием зон роста сливающихся бактерий или сорбитовых ферментирующих и неферментирующих колоний, взятых из SMAC.197

Многочисленные анализы для диагностики STEC были разработаны на основе обнаружения Stx1 и / или Stx2, который представляет основные факторы вирулентности этого E.coli категория.198 Чувствительность и специфичность варьируются в зависимости от формата теста и производителя.199, 200, 201, 202, 203, 204, 205 Тем не менее, стандарты, по которым каждый производитель оценивает свои тесты, также различаются; поэтому прямое сравнение рабочих характеристик различных иммуноанализов не проводилось.198, 206, 207 Более того, эти коммерчески доступные тесты недоступны для развивающихся стран. Таким образом, чтобы обрисовать это, в предыдущих работах были установлены различные форматы иммуноанализов с использованием либо смеси кроличьей сыворотки против Stx1 и анти-Stx2 с помощью непрямого ELISA, либо поликлональных и моноклональных антител в анализе ELISA для обнаружения STEC.207, 208, 209 Стандартизированные методы воспроизводимы, быстры, просты в исполнении, демонстрируют высокую чувствительность при обнаружении Stx с помощью ELISA захвата, даже в низкопродуктивных изолятах. Эти анализы еще не прошли оценку с точки зрения промышленного контроля качества и коммерческой доступности, но ориентировочная стоимость анализа составляет около 70 долларов США за 96 обнаружений, что реально недорого для развивающихся стран.

Эти моноклональные антитела были перестроены, давая в результате одноцепочечные вариабельные фрагменты (scFv).Stx2-scFv был получен из культуры, индуцированной бактериями, и показал диагностическую способность; фрагмент scFv был способен распознавать большинство штаммов, продуцирующих Stx2, с чувствительностью 79,3% (доверительный интервал от 60,3 до 92%), а у непродуцирующих штаммов реактивность не наблюдалась, что указывает на специфичность до 100% (достоверность интервал 86,8–100%) .210 Следует отметить, что ни один из имеющихся в продаже иммуноферментных тестов для обнаружения токсина Stx1 / 2 не использует рекомбинантные антитела, продуцируемые в бактериях, что действительно снизит стоимость диагностических тестов.198

Энтероагрегант

E. coli

EAEC — это диарейный патотип E. coli , определяемый по характерному паттерну AA на эпителиальных клетках в культуре. 211 Паттерн AA был определен в 1987 году, когда Nataro et al. ранее описанное «диффузное прилипание» как истинно диффузное прилипание (DA) и паттерн AA. Стандартный AA был охарактеризован прикрепленными бактериями в виде стопки кирпичей на поверхности эпителиальных клеток, а также на покровном стекле между клетками.Затем штаммы, демонстрирующие паттерн АА, были отнесены к категории «энтероагрегантно-агрегационная E. coli », но впоследствии эта категория была названа энтероагрегативной E. coli или EAEC, текущая номенклатура. Обнаружение AA in vitro по-прежнему является золотым стандартом для определения EAEC; однако, как описано ранее, паттерн AA может быть обнаружен у штаммов других патотипов DEC, таких как aEPEC. Таким образом, современное определение EAEC — это диареи E. coli , которая продуцирует АК в культивируемых эпителиальных клетках, но не имеет основных генетических маркеров, которые определяют другие патотипы DEC (EPEC, ETEC, EHEC, EIEC).Исключением является гибридный штамм EAEC / STEC, ответственный за массовую вспышку диареи и HUS в Европе в 2011 году.213 Этот штамм состоит из штамма EAEC, который приобрел фаг, кодирующий Stx2. Следовательно, этот специфический штамм O104: h5 является EAEC, продуцирующим Stx.

Диарея, вызванная EAEC, водянистая, часто с наличием слизи, с кровью или без нее и болями в животе, рвотой и низкой температурой. Острая, самоограничивающаяся диарея — обычная патология, но у некоторых пациентов может развиться затяжная диарея, i.е. , продолжительностью более 14 дней.214 Продолжительная диарея возникает в зависимости от иммунитета, статуса питания и генетической предрасположенности хозяина.215 Генетическая предрасположенность, связанная с диареей EAEC, была выявлена ​​у путешественников из Северной Америки в Мексику. Однонуклеотидные полиморфизмы (SNP) в промоторе гена IL-8 и промоторных областях генов, кодирующих лактоферрин, CD14 и остеопротегерин, также были признаны индикаторами симптоматической инфекции ЕАЕС. 216, 217, 218, 219

Хорошо описано Характерной чертой штаммов ЕАЕС является их гетерогенность при анализе серотипов, генетических маркеров вирулентности и филогенетических групп.220, 221, 222, 223, 224, 225 Это указывает на то, что только штаммы ЕАЕС, несущие специфические факторы вирулентности, способны вызывать диарею. Хотя эти факторы неизвестны, некоторые исследования продемонстрировали связь конкретных генов вирулентности с диареей, например, pet или aafA в Бразилии226 и sepA в Мали.223

Факторы, механизмы и патогенез вирулентности

Большинство из наши знания о патогенезе ЕАЕС основаны на данных, собранных в исследованиях штамма 042 ЕАЕС, поскольку он был связан с диареей человека в исследовании с участием добровольцев.227 Эти предполагаемые факторы вирулентности включают адгезины, токсины и секретируемые белки. Однако ни один из этих факторов не обнаружен во всех штаммах EAEC.

Большинство этих факторов вирулентности переносятся плазмидами, включая те, которые опосредуют AA. Следовательно, эти высокомолекулярные плазмиды называются pAA. 220 Baudry et al., 228 разработали генетический зонд (CVD432) для диагностики EAEC на основе фрагмента из pAA1, присутствующего в штамме EAEC 17-2. В EAEC 042 многие предполагаемые факторы вирулентности присутствуют в pAA2.220

Недавно было предложено разделение штаммов ЕАЕС на типичные или атипичные подгруппы. Эта классификация основана на наличии или отсутствии aggR , гена, который кодирует глобальный регулятор генов вирулентности EAEC229. Таким образом, было высказано предположение, что типичный EAEC имеет больший патогенный потенциал за счет присутствия регулона AggR и, следовательно, , факторы вирулентности pAA.230 Однако, по крайней мере, две вспышки диареи были вызваны атипичным EAEC, 231, 232 и атипичный EAEC обычно выделяется у детей с диареей, в некоторых случаях чаще, чем типичные штаммы.233, 234

Многочисленные адгезины, цитотоксины, энтеротоксины и секретируемые белки были охарактеризованы в штаммах EAEC с момента определения этого патотипа. 211, 214

Наиболее изученными адгезинами являются фимбрии агрегативной адгезии (AAF / I-AAF / V). который включает пять типов. 235, 236, 237, 238, 239 Они опосредуют паттерн АА и образование биопленок. Афимбриальные адгезины также были охарактеризованы в штаммах EAEC, включая белки внешней мембраны между 30 и 58 кДа. 240, 241, 242. Однако было показано, что эти структуры присутствуют с низкой частотой в коллекциях EAEC из разных мест.221, 226, 243, 244, 245

В pAA2 EAEC 042 находится ген aap , кодирующий белок антиагрегации, называемый дисперсином. 246 Этот белок секретируется и связывается с липополисахаридом, нейтрализуя отрицательный заряд бактериальной поверхности, ведущей к к проекции AAF и последующему распространению по слизистой оболочке кишечника.247 Несмотря на иммуногенность, дисперсин обнаружен у других патотипов E. coli и у комменсала E. coli .248

В EAEC были описаны различные токсины в связи с цитотоксическим действием. или энтеротоксические эффекты супернатантов культур in vitro .Термостабильный энтероагрегант токсина E. coli термостабильный энтеротоксин 1 (EAST-1) был первым токсином, охарактеризованным в патотипе EAEC. 249 EAST-1 активирует аденилатциклазу, вызывая повышенные уровни циклического GMP, эффекты, наблюдаемые в камере Уссинга. с подвздошной кишкой кролика. 250 ShET1 представляет собой токсин типа A: B, который вызывает накопление жидкости в петлях подвздошной кишки кролика и имеет секреторный ответ в анализах камеры Уссинга.251, 252

Два белка AT, охарактеризованные в EAEC 042, Pet и Pic, 253 , 254 являются членами аутотранспортеров сериновой протеазы Enterobacteriaceae, или SPATE.255 Pet — это цитотоксин, который модифицирует цитоскелет энтероцитов, приводя к округлению и отслоению клеток. Цитотоксический механизм Pet возникает из-за деградации α-фодрина, мембранного белка энтероцитов.256 Pic представляет собой многозадачный белок, который опосредует гемагглютинацию, расщепление слизи и гиперсекрецию, кишечную колонизацию у мышей, расщепление поверхностных гликопротеинов, участвующих в переносе лейкоцитов и расщепление ключевых молекул комплемента. 257, 258 Фенотипы, идентифицированные для Pic, предполагают его роль в стимулировании колонизации кишечника и уклонении иммунной системы.SPATE являются иммуногенными белками, о чем свидетельствует наличие в сыворотке крови антител против Pet и Pic у детей, выздоравливающих от диареи, вызванной EAEC.259

В годы, последовавшие за определением EAEC как патотипа, исследования в этой области были посвящены доказательству патогенная способность EAEC с использованием различных моделей животных260, 261, 262 и людей-добровольцев, получавших пероральный инокулят различных штаммов EAEC.227, 235, 263 Не у всех добровольцев развилась диарея после приема внутрь различных штаммов EAEC, что является первым доказательством того, что штаммы этого патотипа являются неоднородный.Среди протестированных штаммов EAEC 042 (серотип O44: h28) вызывал диарею у трех из пяти добровольцев.227 С тех пор штамм 042 считается прототипом штамма EAEC и, безусловно, является наиболее изученным штаммом патотипа.264 EAEC 042 был изолирован от случая острой детской диареи в Перу.265 Клинические данные, полученные от добровольцев, у которых развилась диарея, позволяют предположить, что EAEC 042 вызывает секреторную диарею с обильным присутствием слизи и отсутствием крови в стуле.

Для выяснения патогенеза этого патотипа были проведены исследования с использованием различных штаммов ЕАЕС, взаимодействующих с клетками кишечника животных или людей.Данные этих экспериментов in vitro, , in vivo, и ex vivo, убедительно показывают, что EAEC может связываться с эпителием тощей кишки, подвздошной кишки и толстой кишки по характерному агрегатному образцу, образуя прочную биопленку в слое слизи, за которой следует цитотоксический и токсический эффект. провоспалительные эффекты. 260, 266, 267, 268, 269, 270 Фрагменты терминальной части подвздошной и толстой кишки, вырезанные у детей и взрослых пациентов, инкубировали со штаммами ЕАЕС, которые были способны колонизировать слизистую оболочку подвздошной и толстой кишки по типичному образцу сложенного кирпича над увеличенный слой слизи.270

Все эти доказательства в сочетании с идентификацией нескольких предполагаемых факторов вирулентности в прототипных штаммах ЕАЕС позволили предложить трехэтапную модель патогенеза ЕАЕС: (а) обильное прилипание к слизистой оболочке кишечника, (б) продукция цитотоксины и энтеротоксины, и (c) индукция воспаления слизистой оболочки.211 На первой стадии существенное значение имеет вклад фимбриальных и афимбриальных адгезинов, а также других адгезивных структур. У штаммов EAEC было идентифицировано несколько факторов колонизации.271 На этой стадии характерная повышенная секреция слизи на слизистой оболочке кишечника приводит к образованию прочной биопленки, в которую встроены ЕАЕС. 234, 266, 272 На следующем этапе ЕАЕС оказывает цитотоксическое действие на слизистую оболочку кишечника из-за секреции токсинов, вызывающих везикуляцию микроворсинок, увеличение отверстий крипт и усиление экструзии эпителиальных клеток.266, 273 Воспаление, вызванное ЕАЕС, является результатом сильной колонизации слизистой оболочки кишечника; однако все бактериальные факторы, которые способствуют этому состоянию, не были идентифицированы.Маркеры воспаления, такие как IL-8, IL-1β, интерферон (INF) -γ и лактоферрин, были обнаружены в стуле детей и взрослых, колонизированных EAEC.274, 275, 276 Хотя эта модель суммирует данные, полученные до сих пор с использованием в vivo , in vitro и ex vivo подходы, возможно, не действительны для всех штаммов.

В 2011 году в Европе произошла крупная вспышка кровавой диареи и ГУС, передаваемая через пищевые продукты, от которой пострадали более 4000 пациентов, большинство из которых были из Германии. Эта вспышка была вызвана продуцирующим Stx2 E.coli , относящийся к серотипу O104: h5. Геном этого штамма был быстро секвенирован, что позволило выявить уникальную гибридную комбинацию EAEC и STEC, , т.е. , штамм EAEC Ec55989, несущий профаг, кодирующий токсин 2 Shiga.166, 213 В этом штамме присутствуют несколько факторов вирулентности типичных EAEC, в том числе АггР, Дисперсин, Пик и ШЭТ-1. Также экспрессируются два белка-аутотранспортера Shigella , называемые SigA и SepA, которые участвуют в повреждении и колонизации слизистой оболочки.277, 278 Интересно, что EAEC Ec55989 является штаммом-прототипом для AAF / III. 237 И наоборот, гибридный штамм вспышки продуцирует AAF / I, показывая, что EAEC / STEC при вспышке приобрел плазмиду, кодирующую AAF / I166, 279. Было высказано предположение, что сочетание этих факторов вирулентности является ответственным за высоковирулентные свойства этого штамма.166, 213

Эпидемиология

EAEC — это новый патоген, поражающий детей и взрослых во всем мире, ответственный за случаи острой и стойкой диареи.Тем не менее, наиболее значимое влияние с точки зрения заболеваемости наблюдается среди детей младше 5 лет, проживающих в развивающихся странах.214 Метааналитическое исследование литературы по эпидемиологии диареи, которое включало поиск по EAEC, показало статистическую связь EAEC с острыми заболеваниями. и стойкая диарея в развитых и развивающихся странах, с диареей у ВИЧ-инфицированных пациентов в развивающихся странах и диареей взрослых путешественников.280 В другом метааналитическом исследовании EAEC была связана с острой диареей у детей, живущих в странах Южной Азии.281

Важно отметить, что данные по эпидемиологии инфекции ЕАЕС несколько противоречивы из-за большого различия в методах выявления, географическом положении, возрасте пациентов и социально-экономическом статусе. Тем не менее, EAEC систематически идентифицируется как новый энтеропатоген, тесно связанный с острой и стойкой диареей у детей в развивающихся странах. Более того, в последние годы в развитых странах ЕАЭС часто были изолированы от случаев диареи у детей и взрослых.282, 283

Кроме того, было зарегистрировано несколько вспышек диареи пищевого происхождения, вызванной ЕАЕС, в Европе, Японии, Мексике и Индии 231, 232, 284, 285, 286 Одна из них затронула 2697 школьников в Японии после употребления в пищу школьные обеды.232

В нескольких исследованиях, проведенных в Бразилии, в нескольких исследованиях ЕАЕС-опосредованная стойкая диарея была связана с недостаточностью питания и снижением физического и интеллектуального развития.274, 288, 290 Примечательно, что бессимптомные пациенты, инфицированные EAEC, также демонстрируют задержку роста.274 С момента его определения в качестве патотипа в нескольких исследованиях с участием субъектов с низким социально-экономическим статусом в развивающихся странах сообщалось о высоких показателях бессимптомных маленьких детей с EAEC. 214 Устойчивость ЕАЕС может вызывать хроническое воспаление кишечника даже при отсутствии диареи, снижая его абсорбционную функцию и приводя к недоеданию. 274, 291 Нарушение роста также наблюдалось на мышиной модели оральной инфекции ЕАЕС.292 Учитывая большое количество бессимптомных детей, колонизированных в странах ЕАЭС, в странах с низким уровнем дохода, этот патотип оказывает важное влияние на общественное здоровье как одна из причин нарушения физического и когнитивного развития.

ЕАЕС передается фекально-оральным путем с пищей или загрязненной водой. 232, 285, 286 ЕАЕС были обнаружены в образцах молока из бутылочек для кормления младенцев, которые обрабатывались матерями с низким социально-экономическим статусом293. столовые соусы из мексиканских ресторанов.294 Не было обнаружено никакой связи между штаммами ЕАЕС, выделенными от людей и различных видов животных, что указывает на то, что животные не могут представлять собой резервуар типичных для человека патогенных микроорганизмов ЕАЕС.295

ЕАЕС также появился в последние годы как возбудитель инфекций мочевыводящих путей ( ИМП). Первоначально Abe et al., 296 описали присутствие маркеров вирулентности ЕАЕС в штаммах, выделенных из ИМП, которое впоследствии наблюдали другие.297, 298, 299, 300 Кроме того, присутствие уропатогенных E.coli (UPEC) в коллекциях EAEC 301, 302. Эти результаты указывают на возможность некоторых штаммов EAEC вызывать ИМП.

Вспышка инфекции мочевыводящих путей в сообществе, вызванная штаммом EAEC серотипа O78: h20, произошла в Дании.303 Этот штамм с множественной устойчивостью принадлежал к мультилокусной последовательности типа ST10 и филогенетической группе A. Это был первый случай, когда EAEC была задействована в качестве возбудителя. вспышки внекишечного заболевания. Уропатогенные свойства этого штамма EAEC обусловлены специфическими факторами вирулентности, такими как фимбрии AAF / I.304 Недавно EAEC был признан возбудителем одного случая уросепсиса.300

Выявление и диагностика

Среди патотипов DEC, EAEC наиболее трудно классифицировать, поскольку это очень разнородная группа. Определяющей характеристикой ЕАЕС является узор АА в эпителиальных клетках человека или на стеклянной подложке в виде характерного сложенного кирпича. Таким образом, золотой стандарт для различения ЕАЕС состоит в том, чтобы культивировать пять колоний E. coli на пациента в статическом бульоне Лурия при 37 ° C, а затем инфицировать полуконфлюэнтные клетки HEp-2 в течение 3 или 6 часов в поисках типичный образец AA.212, 305 Однако этот тест требует специального оборудования и занимает много времени, что ограничивает его использование только исследовательскими и определенными справочными лабораториями.

Кроме того, несмотря на то, что несколько белковых компонентов, таких как Pic, ShET1, EAST-1 и Pet, участвуют в вирулентности EAEC, ни один из них не присутствует во всех изолятах. Присутствие Pet в изолятах EAEC было первоначально обнаружено с помощью иммуноблоттинга после предварительного этапа концентрации культурального супернатанта.256 Vilhena-Costa et al.306 разработала иммуноанализ слот-блоттинга, который позволяет избежать стадии концентрирования, что позволяет обнаруживать Pet непосредственно из супернатанта EAEC после выращивания бактериального изолята EAEC в TSB при 37 ° C в течение 4 часов. В этом методе можно было оценить экспрессию Pet со специфичностью и воспроизводимостью, используя кроличью поликлональную сыворотку против Pet, которая не показала перекрестной реакции с супернатантами изолятов, не экспрессирующих Pet, и комменсалом E. coli .

Учитывая эти трудности, ДНК-зонды были включены в качестве ценного инструмента для обнаружения EAEC.307 После секвенирования Eco RI- Pst I фрагмента pCVD432 (зонд AA или EAEC), разработанного Baudry et al., Было сконструировано 228 праймеров, комплементарных этому зонду для амплификации ПЦР.308 Было обнаружено, что этот анализ ПЦР является быстрый, простой и высокочувствительный метод, поэтому считается полезным для скрининга образцов стула на наличие штаммов EAEC. Быстрые и практичные мультиплексные ПЦР-анализы, нацеленные на большее количество генов ( agR , aap и aatA , кодирующие регулятор AggR, дисперсин и белок внешней мембраны системы секреции ABC, соответственно) или aggR , pic и astA , кодирующий AggR, Pic и EAST-1), также использовались для обнаружения штаммов EAEC.309, 310, 311 Монтейро и др. 248 использовали ПЦР для оценки agR , aatA и aap в коллекции из штаммов E. coli и обнаружили, что agR и aatA более специфичны для EAEC. чем aap , что позволяет предположить, что одновременное обнаружение agR , aatA и aaiA (белок системы секреции типа VI) может быть улучшением обнаружения EAEC с помощью ПЦР.

Все эти предложенные протоколы на основе ПЦР обнаруживают плазмидные гены, что не способствует обнаружению атипичных штаммов EAEC.305, 309, 312 Другие, использующие плазмидные и хромосомные локусы, не сообщили о чувствительности и специфичности анализа.226, 313, 314 Однако рекомендуется мультиплексная ПЦР на основе двух генов, кодируемых в плазмиде, и двух хромосомных генов. повышают способность обнаруживать как типичные, так и атипичные штаммы ЕАЕС. Гены agR и aatA 309, 313 и aaiA и aaiG , включенные в анализ, выявляющий aaiA , aaiG , agR и aatA , продемонстрировали.Чувствительность 8% и специфичность 94,3%, и анализ смог эффективно обнаружить обе группы ЕАЕС среди E. coli , выделенных из культур стула.316 Этот метод должен улучшить обнаружение ЕАЕС, поскольку этот патотип отвечает за острую и стойкую диарею у у детей и взрослых, а также ассоциируется со вспышками диарейных заболеваний пищевого происхождения.

Энтеротоксигенный

E. coli

Штаммы ETEC характеризуются продуцированием факторов колонизации (CF) и по крайней мере одного из двух энтеротоксинов: LT и ST.ETEC представляет собой одну из наиболее частых причин диареи у детей в развивающихся странах и у путешественников в эти регионы. ETEC также является экономическим бременем для фермеров и промышленности, поскольку он является важным патогеном для бройлеров, свиней, крупного рогатого скота и других сельскохозяйственных животных. Группа представляет собой очень разнообразный патовар диареиогенных E. coli , несущих мобильные генетические элементы, такие как плазмиды и фаги. Гетерогенность ETEC была впервые продемонстрирована фенотипическими признаками, включая большое разнообразие липополисшакаридов (ЛПС) и состав флагелина, а также экспрессию различных типов CF и токсинов.317, 318 Серологическое типирование штаммов ETEC основано на составе белков внешней мембраны и, в основном, на соматических LPS (O) и жгутиковых (H) антигенах. 318, 319, 320 ETEC составляют более 100 соматических серогрупп (O). и по крайней мере 34 жгутиковых типа (H), объединенных в непредсказуемое количество серотипов O: H, но только ограниченное количество серотипов связано с инфекционными заболеваниями, такими как O8: H9, O6: h26, O78: h22 и O25: h52, и поэтому имеют большое клиническое значение.318, 321

Генетическое разнообразие ETEC также оценивалось с помощью молекулярных подходов, включая случайную амплификацию полиморфной ДНК (RAPD), MLEE, PFGE, мультилокусного типа последовательностей (MLST) и целого секвенирование генома.322, 323, 324, 325, 326, 327, 328, 329, 330 Совсем недавно 362 штамма человеческого происхождения подверглись полногеномному секвенированию следующего поколения; Можно идентифицировать 21 генотип, а штаммы ETEC можно разделить на 5 основных филогрупп (A, B1, B2, D и E) .330 Генетический анализ показал, что клонально связанные линии ETEC, имеющие одинаковые серотипы и профили CF и токсина, имеют всемирное распространение. 327, 328, 330, 331, 332 С другой стороны, генетически отличные штаммы ETEC, часто обнаруживаемые среди бессимптомных субъектов, демонстрируют высокую антигенную гетерогенность в отношении признаков вирулентности и серотипов.333 По-видимому, эти штаммы недавно приобрели гены, кодирующие признаки, связанные с вирулентностью, и их поддержание обусловлено давлением отбора. 328, 330

Факторы, механизмы и патогенез вирулентности

После первоначального открытия связи ETEC с диарейным заболеванием у людей в 1950-х годах предпринимались интенсивные усилия по выявлению признаков, связанных с вирулентностью ETEC, которые могли бы помочь понять физиологию патологического процесса и привести к разработке конкретных диагностических методов.Штаммы ETEC обычно продуцируют адгезины, или CF, протеиновый комплекс, который может принимать форму фимбриальных, фибриллярных или нефимбриальных структур на бактериальной поверхности. Адгезины, экспрессируемые штаммами ETEC, способствуют прикреплению бактерий к слизистой оболочке кишечника и придают специфичность к хозяину различным штаммам.317, 321

Приблизительно 30 антигенно различных CF были идентифицированы в клинически значимых штаммах ETEC, но обычно только несколько найдено среди образцов, собранных у больных диареей.317, 330 Помимо различий в отношении биогенеза и структурной организации, CF ETEC демонстрируют специфические антигенные, генетические и биохимические особенности, которые в настоящее время используются для объединения их в три основные группы: группа, подобная антигену I фактора колонизации (CFA / I), coli группа, подобная поверхностному антигену 5 (CS5), и группа класса 1b. 317, 334, 335 Группа, подобная CFA / I, содержит первый описанный CF (CFA / I) и некоторые из наиболее клинически распространенных CF, включая CS1, CS2 , CS4, CS14, CS17, CS19 и предполагаемый фактор колонизации O71 (PCFO71), тогда как CS5-подобная группа включает только CS5 и CS7.Группа класса 1b включает CS12, CS18, CS20 и недавно описанные типы CS26-28 и CS30. 317, 334, 335 Кроме того, генетические отношения также наблюдаются между штаммами, экспрессирующими CS8 и CS21, CS13 и CS23, а также между штаммами, экспрессирующими CS15 и CS22.336, 337, 338 Другие ранее охарактеризованные CF, такие как CS3, CS6, CS10 и CS11, не относятся к известным семействам CS.317 Некоторые CF, такие как CS18 и CS20, относятся к ETEC свиного происхождения. fimbriae, которые демонстрируют меньшую гетерогенность, чем те, которые обнаруживаются в штаммах, выделенных от человека.317, 321, 339 Штаммы, экспрессирующие CFA / I, CFA-II (CS1 / CS3, CS2 / CS3 или CS3), CFA-IV (CS4 / CS6, CS5 / CS6 или CS6), CS17 и / или CS21, являются наиболее распространенными CF, обнаруженные в эпидемиологических исследованиях, тогда как другие CF обнаружены в штаммах ETEC, явно не связанных с диарейным заболеванием. 317, 318, 331

После прилипания к слизистой оболочке кишечника штаммы ETEC вырабатывают энтеротоксины, которые считаются вторым компонентом, связанным с диарейным заболеванием. болезнь. Среди штаммов ETEC, выделенных либо от человека, либо от других животных-хозяев, были идентифицированы две основные категории энтеротоксинов: LT и ST.Оба типа токсинов опосредуют нарушение регуляции мембранных ионных каналов в эпителиальной мембране, что приводит к потере ионов и огромному количеству воды, основной характеристике водянистой диареи, вызываемой этими штаммами бактерий.340

LT состоят из пяти идентичных мономеров (11,5 кДа) в форме кольца с образованием пентамерной субъединицы В и субъединицы А размером 28 кДа, связанной с субъединицей В спиральным доменом А2. Субъединица B связывается с рецепторами клеточной поверхности, особенно с ганглиозидами, способствуя интернализации токсина и ретроградному транспорту до эндоплазматического ретикулума, где домен A1 отщепляется от домена A2 и высвобождается в цитоплазму.Домен A1 переносит часть ADP-рибозы от кофактора NAD + к стимулирующему G-белку, который становится активным и способен стимулировать аденилатциклазу, что приводит к внутриклеточному увеличению циклического аденозинмонофосфата (цАМФ). Более высокие уровни цАМФ в клетке вызывают активацию протеинкиназы А, что, в свою очередь, приводит к фосфорилированию ионных каналов, что приводит к высвобождению Cl , а также снижению поглощения Na + и, как следствие, массовому высвобождению воды в просвет кишечника. основная характеристика секреторной диареи, вызванной этими патогенами.6, 341 ST, мономерный белок с массой около 5 кДа, также может вызывать осмотическое нарушение регуляции, непосредственно активируя гуанилатциклазу C, расположенную на апикальной мембране кишечных клеток, с образованием внутриклеточного циклического гуанозинмонофосфата и, следовательно, с секрецией Cl . ионы и вода из кишечного эпителия. Однако вариант ST, впервые выделенный от свиней, проявляет отчетливую физиологическую активность, характеризующуюся потерей эпителиальных клеток ворсинок и чистой секрецией бикарбоната.6 Токсины LT и ST, по отдельности или в комбинации, способны вызывать клеточный водно-электролитный дисбаланс, что, несомненно, способствует патогенезу ETEC.

Отличительной чертой биологии ETEC является экспрессия энтеротоксинов, которые также обладают значительной антигенной гетерогенностью. Приблизительно одна треть штаммов, выделенных от пациентов с диареей, экспрессирует только LT или только ST, в то время как другая треть экспрессирует оба типа токсинов. Кроме того, были идентифицированы две несвязанные группы ST с различными функциональными и структурными особенностями: (i) STa, включающая два варианта (STh и STp), ассоциированных с заболеванием человека, и (ii) STb, которая обычно встречается среди свиней. производные штаммы ETEC.Точно так же LT делятся на две антигенно разные группы: LT-I и LT-II.6 Первоначально были описаны два варианта LT-I, выделенные из ETEC человека или свиньи (LTh и LTp, соответственно), и было показано, что они имеют высокая идентичность аминокислотной последовательности и сходные, но не равные антигенные, биохимические и рецептор-связывающие свойства.342, 343 Родственные варианты LT-II (LT-IIa, -IIb, -IIc) были выделены от людей или других хозяев и заражены пищи и связываются с разными рецепторами.344, 345, 346, 347 LT-IIa, LT-IIb и LT-IIc разделяют 51, 52 и 49% или 15, 16 и 7% идентичности с LT-Ih в отношении субъединиц A и B соответственно 347, 348

Совсем недавно пионерское исследование, проведенное со штаммами ETEC, выделенными в Бразилии, продемонстрировало довольно высокую внутривидовую вариабельность LTh между продуцирующими LT штаммами ETEC.333, 349, 350 В коллекции из 51 штамма ETEC, экспрессирующих LT и / или ST, 50 В генах, кодирующих LT, были обнаружены генетические полиморфные сайты, которые выявили 16 природных вариантов LT в соответствии с различиями в аминокислотных последовательностях.Среди этих вариантов, названных от LT1 до LT16, два (LT1 и LT2) были связаны с ограниченным числом серотипов с глобальным распределением и в основном изолированы от пациентов с диареей.333 Напротив, большинство обнаруженных вариантов LT наблюдались среди продуцирующих LT Штаммы ETEC, выделенные от бессимптомных субъектов333. Совсем недавно в более крупной коллекции штаммов ETEC, выделенных из разных регионов мира, было идентифицировано 12 дополнительных типов LT35. штаммы, выделенные от свиней (LTp), и гены, кодирующие ST.352, 353

Естественное разнообразие типов LT, обнаруженное среди штаммов ETEC, выделенных у людей с симптомами и бессимптомно, предполагает, что некоторые типы LT могут проявлять более высокую токсичность для эукариотических клеток и могут экспрессироваться на разных уровнях по сравнению с другими типами токсинов. Действительно, предыдущие наблюдения показали, что некоторые типы LT обладают различной токсичностью в условиях in vitro, и in vivo, .333, 349, 350 Естественный вариант LT, аналогичный LT, экспрессируемому штаммами свиного происхождения, показал снижение токсичность из-за замены аминокислоты в ключевом полиморфном сайте в субъединице A.333, 350 Это изменение аминокислоты привело к менее гибкой структуре субъединицы А, нарушив соответствующий контакт с кофактором (NAD + ) в каталитическом сайте.350 Другие авторы наблюдали, что естественный полиморфизм в субъединице B приводит к снижению связывания рецептора и, следовательно, сниженная токсичность для эукариотических клеток.352 Эти результаты предполагают, что присутствие штаммов ETEC, экспрессирующих различные варианты LT, может коррелировать с частотой появления симптомов среди инфицированных субъектов, особенно среди инфицированных младенцев, ранее не подвергавшихся инфекциям ETEC.

Вариабельная экспрессия LT также может влиять на тяжесть заболевания, связанного с ETEC. Предыдущие наблюдения показали, что количества LT, продуцируемые и / или секретируемые ETEC, резко различаются между штаммами и клиническими изолятами.332, 351, 354, 355, 356 Можно обнаружить наличие однонуклеотидных изменений в регуляторной области оперона etx . и, по крайней мере, для некоторых из них, связаны с различной транскрипционной и трансляционной активностью среди диких штаммов ETEC.332 , неопубликованные данные Тем не менее, необходимы дальнейшие исследования, чтобы продемонстрировать четкую связь между транскрипционными и посттранскрипционными событиями и тяжестью симптомов, связанных с инфекцией ETEC.

Эпидемиология

Ежегодно инфекции, вызванные различными штаммами ETEC, вызывают удивительное количество диарейных эпизодов, значительно превышающих 200 миллионов случаев и вызывающих около 75 000 смертей, в основном среди младенцев и маленьких детей в тропических районах с плохими санитарными условиями.118, 357 В Бразилии эпидемиологические данные, собранные в разное время между 1978 и 2007 годами, показали, что частота диареи, вызванной ETEC, колеблется от 3,5 до 20,45% .115, 358, 359, 360, 361

Выявление и диагностика

Это Патотип в основном характеризуется производимыми им энтеротоксинами, и диагноз зависит от выявления LT и / или ST. Один или оба токсина могут экспрессироваться штаммами ETEC. 340, 362, 363, 364 Диагностика штаммов ETEC должна включать, в дополнение к обнаружению LT и ST, дополнительные ПЦР-анализы для обнаружения генов вирулентности, таких как clyA , eatA , tia , tibC , leoA и east-1 .340 Чувствительный и специфический анализ ПЦР с праймерами, нацеленными на гены lt и st , был описан Stacy-Phipps et al., 365 и позже Youmans et al., 366 с использованием количественной ПЦР в реальном времени. Кроме того, было разработано несколько анализов мультиплексной ПЦР с использованием этих двух генов. 367, 368, 369

Фенотипическое обнаружение ETEC первоначально проводили с использованием супернатантов, полученных из одиночных колоний E. coli , и с помощью трудоемких процедур, таких как тест подвздошной петли кролика, 370 анализ на сосущих мышах371 или исследования цитопатического эффекта на монослоях клеток СНО или Y1 надпочечников, в которых на присутствие LT в супернатантах указывалось округление клеток Y1 или удлинение клеток CHO через 24 часа инкубации.372, 373

Для обнаружения ST был разработан ряд иммуноанализов, включая радиоиммуноанализ и иммуноферментный анализ (ELISA). Оба теста хорошо коррелируют с результатами, полученными с помощью анализа на подсосных мышах, и требуют значительно меньшего опыта.374, 375 анализов ELISA были затем разработаны с использованием рецептора GM 1 для связывания LT, полученного из отфильтрованных супернатантов культур или с использованием конкурентного теста на LT, который заменил прежние процедуры.376

Иммунологические тесты для обнаружения LT включают традиционный тест Бикена, латекс-агглютинацию, а также надежные и простые в выполнении коммерчески доступные тесты, такие как обратная пассивная латексная агглютинация и тест на стафилококковую коагглютинацию.321 Было описано несколько иммунологических анализов, в которых LT захватывается либо ганглиозидом GM1 (его рецептор в клетке-хозяине), либо антителами. 139, 321, 377, 378 Анализы на ST с помощью непрямого ELISA с использованием IgG1 ST-mAb и LT путем захвата ELISA с использованием обогащенной IgG фракции поликлонального кролика в качестве захватывающего антитела и LT-mAb IgG2b в качестве второго антитела был использован в качестве инструментов для диагностики. Присутствие солей желчных кислот и использование некоторых антибиотиков улучшают выработку / высвобождение токсина ETEC.Тритон Х-100, как химическая обработка, оказался альтернативным методом высвобождения токсина. Следовательно, общий протокол, который может увеличить продукцию и высвобождение LT и ST, может облегчить и повысить чувствительность диагностических тестов для ETEC.355 После этого эти моноклональные антитела были перестроены, что привело к образованию фрагментов одноцепочечного вариабельного фрагмента (scFv). Разработанные рекомбинантные scFv против LT и ST представляют собой многообещающую отправную точку для простой и экономичной диагностики ETEC.379

Энтероинвазивный

E. coli

Энтероинвазивный E. coli (EIEC) является возбудителем дизентерии у людей, особенно в развивающихся странах. 380 Он вызывает кератоконъюнктивит у экспериментальных морских свинок381 и поражает клетки толстой кишки человека, вызывая инфекция, аналогичная той, что вызывается Shigella sp.382, 383 Первое описание EIEC было выполнено EWING и GRAWATTI в 1947 г. 384 Первые работы, подчеркивающие особые биохимические характеристики образцов EIEC, были представлены в 1967 г. Trabulsi et al., 385 в Бразилии и Саказаки и др., 386 в Японии. Все исследованные изоляты были положительными по тесту Серени (кератоконъюнктивит морских свинок), а штаммы были отрицательными по лизиндекарбоксилазе, поздно ферментирующим лактозу и в целом неподвижны, за исключением образцов серогруппы O124. Изучение биохимического поведения 97 образцов EIEC381 подтвердило ранее полученные результаты. Было показано, что эта группа диареи E. coli принадлежала к четко определенным биосеротипам, O28ac: H-, O29: H-, O112ac: H-, O121: H-, O124: H-, O124: h40, O135: H-, O136: H-, O143: H, O144: H-, O152: H-, O159: ​​H-, O164: H-, O167: H- и O173: H-.381, 387, 388, 389 В 1964 году было продемонстрировано, что образцы серогрупп O32 и O42 из E. coli также обладали способностью вызывать кератоконъюнктивит у морских свинок.389 Однако существование энтероинвазивных биосеротипов в серогруппе O42 было очевидным. не подтверждено, и биосеротип O32 на самом деле является аэрогенным вариантом S. boydii 14, как показано Toledo et al.390. Имеются сообщения о выделении образцов EIEC, принадлежащих другим мобильным серотипам, O144h35391; однако это единичные случаи.Недавно серотип E. coli O96: h29 был описан как энтероинвазивный E. coli в двух крупных вспышках, произошедших в Италии и Соединенном Королевстве.392, 393 Стоит отметить, что серотипы EIEC, считающиеся неподвижными, производят необычно большой (77 кДа) флагеллин, который собран в функциональные филаменты жгутика, которые позволяют бактериям плавать в модифицированном агаре подвижности (0,2%). 394 Анализ гена fliC показал, что 11 различных серотипов EIEC имеют шесть молекулярных профилей fliC .Основные серотипы EIEC показали низкое разнообразие fliC. Дендрограмма показала два основных кластера, предполагая два разных происхождения гена флагеллина среди этих штаммов. Кроме того, наличие одного и того же паттерна среди штаммов одного и того же серотипа предполагает существование общего клона.395

Факторы, механизмы и патогенез вирулентности

Диарея, вызванная EIEC и Shigella, вызывается инвазией и проникновением бактерий в энтероциты, что приводит к их разрушению.Эти бактерии специфически связываются со слизистой оболочкой толстой кишки и проникают в клетки посредством эндоцитоза. 396, 397
Штаммы Shigella flexneri используются в качестве матрицы для большинства исследований инвазии.

Сложный процесс колонизации и выживания EIEC в желудочно-кишечном барьере зависит от присутствия большой плазмиды размером около 220 т.п.н. ( pInv ), очень похожей на плазмиду, обнаруженную в Shigella .397, 398, 399, 400 In В этом процессе задействованы множественные бактериальные гены, как хромосомные, так и плазмидные.Бактерии без плазмиды вирулентности не вызывают кератоконъюнктивита у морских свинок, так как они считаются невирулентными.397, 401

Большинство этих функций связано с белками, кодируемыми фрагментом размером 31 т.п.н. из pInv , содержащего 38 генов. В этом фрагменте находятся гены, ответственные за бактериальную инвазию и ускользание, распространение клеток, ингибирование аутофагии, регуляцию иммунного ответа аппарата хозяина и системы секреции типа III (TTSS). После введения в клетку-хозяина вирулентность или эффекторные факторы индуцируют или ингибируют клеточные сигнальные пути.Изменения в клетках-хозяевах, вызванные бактериями, обеспечивают внутриклеточное выживание этих микроорганизмов.402, 403, 404

Из-за большого сходства между Shigella и EIEC можно предположить, что у них был один и тот же предок и В данный момент в эволюции произошло разделение. Почему EIEC сохранил свойств E. coli , которые были утрачены в нескольких линиях Shigella ? Данные, полученные разными группами, позволяют предположить, что штаммы EIEC находятся на промежуточной стадии и являются потенциальным предшественником «полномасштабных» штаммов Shigella .405, 406, 407, 408, 409

Несмотря на сходство механизма инвазии и симптомов заболевания (дизентерия), инфекционная доза EIEC намного выше, чем у Shigella .410 Кроме того, болезнь, вызванная EIEC, кажется быть более мягкой и самоограничивающейся формой.

В тесте Серени было замечено, что EIEC вызывает более легкую форму заболевания (легкое / умеренное воспаление), в то время как Shigella приводит к обострению провоспалительной реакции (тяжелое воспаление).Более того, кератоконъюнктивит развивается быстрее у морских свинок, инокулированных Shigella (два дня), чем у морских свинок, инокулированных EIEC (4–5 дней). 411

Образцы различных серотипов EIEC показали полиморфизм в некоторых участках вовлеченных генов. во вторжении. Однако данные показывают, что нет никаких изменений в генах антигенов инвазионной плазмиды, которые могли бы объяснить различия в патогенности между Shigella и EIEC.400 Более того, недавние исследования нашей группы показали, что гены, ответственные за распространение клеток ( icsA и icsB ) и регуляция иммунного ответа хозяина ( osp ) не указали на изменения, которые могли бы объяснить разницу в патогенности между Shigella и EIEC (данные не показаны).

Еще одним важным аспектом бактериальной колонизации является поглощение железа (Fe) в условиях, ограниченных хозяином. Железо является важным элементом для всех живых организмов. По оценкам, микроорганизмы нуждаются в железе в концентрациях от 10 до 10 -6 М для удовлетворения своих метаболических потребностей. Было показано, что EIEC обладает высокой адаптируемостью, используя при необходимости систему улавливания железа, которая потребляет меньше энергии. Способность улавливать Fe из разных источников может способствовать развитию инфекционных процессов этой бактерией.412, 413

EIEC, как и другие кишечные патогены, нацелены на М-клетки ( микроскладчатых клеток, ), присутствующие в слизистой оболочке кишечника в качестве пути проникновения в более глубокие ткани хозяина. 403, 414 Достигая пластинки через М-клетки, бактериальные клетки фагоцитируются макрофагами и дендритными клетками. Эти клетки являются первым шагом в производстве воспалительного ответа против бактериальной инвазии. После выхода из макрофагов и дендритных клеток EIEC может проникать в клетки энтероцитов с базолатеральной стороны, ускользая из фагосомы и реплицируясь в цитоплазме.403, 414

Наша группа впервые описала фенотипические и генотипические характеристики, объясняющие более низкую способность EIEC вызывать заболевание по сравнению с видами Shigella . С этой целью использовались экспериментальные модели, имитирующие кишечное микроокружение хозяина, такие как культуры кишечных эпителиальных клеток, макрофагов и дендритных клеток.411, 415, 416 Наши результаты показали, что первоначальная способность проникать в кишечные клетки аналогичен между EIEC и Shigella , но экспрессия генов вирулентности ( ipaABCD , icsA , icsB , virF , virB ), способность ускользать от фагосомы, внутриклеточная диссеминация и распространение EIEC, а также способность вызывать повреждение клеток во время инфекции намного ниже, чем у S.flexneri .411 Значительно большее количество EIEC наблюдается внутри макрофагов по сравнению с Shigella после фагоцитоза. Кроме того, Shigella демонстрирует большую способность к побегу из макрофагов по сравнению с EIEC. Было обнаружено, что экспрессия генов вирулентности, продукция провоспалительных цитокинов и гибель клеток были меньше в макрофагах, инфицированных EIEC, по сравнению с Shigella . Следует отметить, что продукция противовоспалительного цитокина IL-10 макрофагами выше при инфицировании EIEC, чем Shigella .415

Было оценено взаимодействие EIEC с дендритными клетками. Данные свидетельствуют о том, что EIEC индуцирует продукцию IL-10, IL-12 и TNF-α инфицированными дендритными клетками, в то время как S. flexneri индуцирует продукцию TNF-α. В отличие от Shigella , инфицирование EIEC увеличивает экспрессию рецепторов TLR-4 и TLR-5 на дендритных клетках и снижает экспрессию костимулирующих молекул, которые могут взаимодействовать, чтобы вызвать пролиферацию Т-лимфоцитов, и, кроме того, увеличивается пролиферация лимфоцитов, зараженных S.flexneri , чем с EIEC. 416

Эпидемиология

Штаммы EIEC имеют биохимические, генетические и патогенные характеристики, аналогичные видам Shigella , что часто затрудняет правильную идентификацию этого патотипа. 381, 385, 386, 417 Эпидемиологические данные может быть недооценен из-за трудности дифференциации между Shigella и EIEC.

EIEC был ответственен за несколько вспышек, но сообщений о путях передачи и распространения этой бактерии в природе немного.Вода и сыр были описаны как потенциальные источники 418, 419, 420, 421, а также прямые передачи при контакте от человека к человеку.422 В 1970-х годах в США была зарегистрирована крупная вспышка диареи, от которой пострадали 387 человек. пациенты. Транспортным средством передачи был импортный сыр, загрязненный серогруппой O124.419 По данным Управления по контролю за продуктами питания и лекарствами США ( Управление по санитарному надзору за качеством пищевых продуктов и медикаментов — FDA ), вспышки, вызванные EIEC, были связаны с молоком и молочными продуктами и говядина; однако любая пища или вода, загрязненные человеческими фекалиями отдельного пациента, могут вызывать заболевание у других людей.423 В Бразилии имеется отчет о трех пробах, выделенных из воды. 421 Вспышки с участием двух EIEC были недавно зарегистрированы в Европе, одна в Италии в 2012 году, когда было 109 случаев, а другая в Соединенном Королевстве в 2014 году с участием 50 случаев. 392, 393 В Оба, овощи были виноваты.

В Калькутте распространенность EIEC в группе из 263 пациентов, госпитализированных с диареей, была высокой, 16,3% случаев.424 Однако есть сообщения о распространенности 2% .425 В Таиланде, Китае и других странах Азии a была замечена распространенность от 4 до 7%.426, 427, 428, 429 В Боливии отчеты показали распространенность 2 %.430 Некоторые исследования показали, что в Нигерии, Иране и Таиланде распределение EIEC ниже (менее 0,1%), чем в развитых странах; в Испании, например, была обнаружена распространенность 0,2% 431, 432, 433, 434 Низкая заболеваемость может быть связана с трудностями дифференциации EIEC от Shigella.

Изоляция EIEC в Бразилии колеблется от 0,5 до 15%, в зависимости от исследуемой популяции. 435, 436, 437, 438, 439, 440 Данные показывают, что наличие EIEC связано с социально-экономическими условиями.Толедо и Трабульси439 исследовали присутствие этого микроорганизма у детей в возрасте до пяти лет и детей, не проживающих в трущобах, из разных районов города Сан-Паулу. Эта бактерия была обнаружена у 17 из 107 детей, живущих в трущобах, с диареей (15,9%) и у 16 ​​из 701 ребенка, живущего в трущобах, с диареей (2,3%). В первой группе EIEC был энтеропатогеном, наиболее часто выделяемым у детей старше 2 лет. У детей того же возраста, не проживающих в трущобах, он был четвертым по распространенности возбудителем, более частым, чем EPEC, Salmonella , Rotavirus и Yersinia enterocolitica .Исследования, проведенные за пределами города Сан-Паулу, показали низкую распространенность этих бактерий, 0,5–2,5% .435, 440

Обнаружение и диагностика

Образцы EIEC хорошо растут в культуральной среде, обычно используемой для изоляции Enterobacteriaceae, такой как агар МакКонки. , ксилозо-лизин-дезоксихолатный (XLD) агар и Hektoen enteric (HE). Высокоселективные среды, такие как агар Salmonella Shigella (SS) или агар с сульфитом висмута, могут быть не столь эффективны для некоторых серотипов.381

Идентификация E.coli можно проводить с использованием обычных биохимических тестов, таких как производство индола, ферментация глюкозы, сахарозы и лактозы, образование газа в результате ферментации глюкозы, ферментация глюкозы путем метаболизма с использованием цитрата в качестве единственного источника углерода, подвижность, лизин, аргинин и орнитин. декарбоксилирование.1, 441 Ферментация лактозы зависит от штамма; Образцы EIEC могут ферментировать лактозу медленно (72 часа), что затрудняет дифференциацию от Shigella .381 В дополнение к физиологическим и биохимическим характеристикам для дифференциации может потребоваться серотипирование, поскольку некоторые серотипы S.flexneri производят индол. В таких случаях следует использовать O-антисыворотку против EIEC и Shigella .1, 441 Бактериальные колонии с этой характеристикой могут быть проверены на классические серогруппы EIEC O28ac, O29, O112, O124, O136, O143, O144, O152, O159, O164, O169 и O173.1, 441, 443 Инвазивная способность EIEC может быть оценена с помощью теста глаза морской свинки Sereny444 и тестов тканевых культур 445, которые более заметно ограничены справочными лабораториями.

Для характеристики патотипа EIEC необходим поиск генов вирулентности плазмид.В настоящее время рекомендуется исследование гена ipaH , мультикопийного гена (4-10), присутствующего в EIEC и Shigella , с помощью ПЦР, 442, 446 или необходимы исследования других последовательностей ДНК, таких как инвазия -ассоциированный ген локуса ( ial ) .447 Присутствие генов iudA и lacY может дифференцировать EIEC от S. flexneri . 446 Был проведен простой и быстрый тест стула, основанный на активности апиразы (АТФ-дифосфогидролазы). описан для обнаружения EIEC.448 Это важный периплазматический фермент, необходимый для униполярной локализации IcsA, который участвует во внутриклеточном и межклеточном распространении патогена и экспрессируется только EIEC и Shigella . 449 Активность фермента измеряется колориметрической реакцией. Этот метод надежен, требует широко доступного оборудования и доступных реагентов и может применяться для повседневного использования в лабораториях с ограниченными ресурсами. 448

Предупреждающие огни для автомобилей — на что указывают эти индикаторы на приборной панели

Знайте символы приборной панели автомобиля и их значение

В наши дни автомобиль превратился в нечто большее, чем просто средство передвижения.Он превзошел возраст, когда вещи проверялись вручную через регулярные промежутки времени. Те, кто владел автомобилями старшего поколения, обычно беспокоились, все ли под капотом, снаружи машины или внутри салона работают нормально. Причина в том, что в то время на приборной панели не было ничего похожего на сигнальные лампы автомобиля.

Но теперь автомобили стали настолько сложными, насколько вы можете себе представить. Теперь они оснащены электронными датчиками, которые обнаруживают любую неисправность в автомобиле и вовремя предупреждают вас, что упрощает наблюдение за автомобилем.Современная приборная панель оснащена множеством сигнальных ламп, которые указывают на проблемы, возникшие в вашем автомобиле, или заранее предупреждают вас о ключевых областях, требующих немедленной проверки. А чтобы своевременно принять меры, любому автовладельцу очень важно разбираться в сигнальных лампах приборной панели автомобиля.

Итак, давайте ознакомимся со всеми сигнальными лампами автомобиля и разберемся, что они означают:

Сигнальная лампа тормозной жидкости —

Этот свет начинает загораться, когда тормоза автомобиля усложняются.Поскольку тормоз — одна из самых важных частей автомобиля, настоятельно рекомендуется сразу же проверить его. Этот индикатор также указывает на низкий уровень тормозной жидкости. В этом случае как можно скорее залейте тормозную жидкость.

Контрольная лампа двигателя —

Если этот индикатор горит, это может означать отсутствие питания, поскольку автомобиль перешел в безопасный режим для самозащиты, возможно, из-за неисправности в системе управления двигателем. Иногда это может быть из-за неисправного электрического датчика или из-за более серьезной проблемы, которая может вызвать непоправимый ущерб.

Сигнальная лампа подушки безопасности —

Неисправная подушка безопасности не сработает во время аварии, что означает, что пассажир и водитель могут получить серьезные травмы, а также раскрытие подушки безопасности может быть настолько неприятным, что может вызвать сотрясение и травму.

Сигнальная лампа усилителя рулевого управления —

Если этот индикатор горит, это означает, что в вашем рулевом управлении с усилителем возникла проблема, которая переводит ваше рулевое управление, переводя движение в тяжелый режим, в котором вам потребуется дополнительное усилие, чтобы заставить ваш автомобиль двигаться.

Сигнальная лампа сажевого фильтра дизельного двигателя —

Большинство современных автомобилей оснащено «дизельным сажевым фильтром», который удаляет вредную сажу из выхлопных газов с целью снижения выбросов. Если этот фильтр выходит из строя, на приборной панели загорается свет. Неисправность в этом случае приведет к выпуску черного дыма при каждом нажатии на педаль акселератора, а также может вызвать повреждение двигателя.

Контрольная лампа охлаждающей жидкости —

Когда появляется этот индикатор, это означает, что уровень охлаждающей жидкости низкий.Это также может означать возможность перегрева двигателя, и вам необходимо немедленно остановить автомобиль.

Контрольная лампа масла —

Загорается при слишком высокой температуре масла, низком уровне масла или давлении масла. В этот момент следует немедленно остановить двигатель транспортного средства, чтобы избежать серьезного повреждения двигателя. Следует обратиться за профессиональной помощью, чтобы обеспечить поддержание правильного уровня и давления масла.

Контрольная лампа контроля давления в шинах —

Эта система предназначена для определения отклонения от нормального давления в шинах.

Сигнальная лампа заряда аккумулятора —

Этот предупредительный световой сигнал загорается при включении автомобиля, но если он не гаснет через несколько секунд после запуска двигателя, это означает, что возникла проблема с электрической системой вашего автомобиля. Необходимо немедленно обратиться за помощью к механику.

Задний противотуманный фонарь —

Он остается включенным, как только водитель включает задние противотуманные фары. Если есть какая-то проблема, она может не работать, и вам нужно ее проверить.

Напоминание о ремне безопасности —

Этот свет будет гореть, пока вы и все пассажиры не пристегнете ремни безопасности.Свет может сопровождаться звуковым сигналом.

Индикаторы открытых дверей —

Этот символ загорается, когда водитель заводит машину, а одна или несколько дверей закрываются неправильно. Когда вы закроете все двери должным образом, он выключится.

Сигнальная лампа опасности —

Указывает на то, что с транспортным средством возникла проблема, и другим водителям необходимо осторожно пересекать транспортное средство, чтобы избежать столкновения.

Контрольная лампа ABS —

Загорается при неисправности системы ABS автомобиля.

Сигнальная лампа неисправности лампы —

Этот символ указывает на то, что в одной или нескольких лампах вашего автомобиля что-то не так и ее необходимо заменить.

Размораживание заднего стекла —

Когда на лобовом стекле появляется слой тумана, он поднимается, и как только окно очищается, вы должны выключить его, чтобы сэкономить заряд батареи.

Замок для безопасности детей —

Если он начинает светиться, это означает, что активирована блокировка для безопасности детей.ВЫКЛЮЧАЙТЕ, когда это не требуется.

Круиз-контроль —

Этот свет загорается, когда круиз-контроль находится в активном режиме. Эта функция есть не во всех автомобилях.

Размораживание лобового стекла —

Чтобы убрать иней с переднего экрана, водитель включает его, а когда экран очищается, он должен быть ВЫКЛЮЧЕН для экономии заряда батареи.

Неисправность трансмиссии —

Загорается, когда есть проблема с двигателем, и он требует немедленной остановки двигателя.Немедленно доставьте машину в сервисный центр, если это произойдет.

Контрольная лампа тяги —

Этот индикатор горит вместе с АБС, когда в автомобиле неисправна система. Он также будет мигать, когда система работает, чтобы предупредить водителя об опасных условиях.

Электронная лампа управления дроссельной заслонкой —

Этот индикатор указывает на неисправность в электронной системе управления дроссельной заслонкой.

Индикатор AWD —

Указывает, что активирован полный привод.Опять же, не в каждой машине есть эта функция.

ESP / BAS свет —

Он предназначен для информирования водителя о потенциальной проблеме с технологией электронной системы стабилизации. Он очень похож на индикатор ABS.

Индикатор повышающей передачи —

Это означает, что система перегрузки выключена.

Уведомление о низком уровне топлива —

Обычно это происходит, когда уровень топлива становится очень низким и возникает необходимость дозаправки. Если он не работает должным образом, его необходимо немедленно проверить, иначе вы столкнетесь с проблемами с интервалами заправки топливом.

Предупреждение о свечах накаливания —

Используется в дизельных транспортных средствах. Запрещается предпринимать попытки завести двигатель, пока этот свет не погаснет. Свет также предупреждает пользователя об обнаружении неисправности в системе управления двигателем.

Повороты —

Без сомнения, самые важные индикаторы для любого автомобиля, эти указатели поворота активируются, когда водитель меняет направление и использует индикатор.

Фара дальнего света —

Активируется, когда водитель включает режим дальнего света фар.Его использование в основном ограничено движением по шоссе. На узких дорогах следует избегать дальнего света, так как вы не получите ни малейшего представления о ухабах.

Эпигенетическая модуляция иммунных синаптических-цитоскелетных сетей усиливает опосредованную γδ Т-клетками цитотоксичность при раке легких

Линии раковых клеток и лекарственное лечение

Клеточные линии рака легких человека, A549, h2299, HCC827, PC-9, PC-9-IR , h3981, h257, h2792, h3170 и линия клеток колоректального рака, HCT116, были получены из Американской коллекции типовых культур (ATCC).Клеточные линии аденокарциномы легких человека CL1-0 и CL1-5 были любезно предоставлены профессором Пан-Чир Янгом из Медицинского колледжа Национального Тайваньского университета 69 (дополнительная таблица 1). Клетки выращивали в среде HyClone PRMI (Sh40027.02, GE Healthcare) с добавлением 10% диализованного GIBCO FBS (26140-079, Life Technologies), 1% l-глутамина (A29168-01, Life Technologies) и 1% пенициллина. стрептомицин (15140-122, Life Technologies). Аутентификация всех клеточных линий, использованных в этом исследовании, была проведена с использованием анализа коротких тандемных повторов (STR).Для экспериментов по лечению лекарственными препаратами клетки культивировали с 100 нМ децитабина (DAC; A3656, Sigma-Aldrich) в течение 3 дней с ежедневной сменой полной среды и пополнением лекарственного средства с последующими 3–4 днями восстановления клеток в среде без децитабина. Чтобы заблокировать влияние DAC на формирование иммунных синапсов посредством реорганизации актинового цитоскелета, клетки, предварительно обработанные DAC (D3R3), обрабатывали 1 мкг / мл цитохалазина B (Cyto B; C6762, Sigma-Aldrich) в течение 1,5 ч перед совместным культивированием с γδ T клетки.

Маркировка SILAC

Для количественного масс-спектрометрического анализа клетки рака легких культивировали для получения не менее семи удвоений клеток в среде SILAC RPMI (88365, Thermo Fisher Scientific) с добавлением 10% FBS и меченных тяжелыми изотопами аминокислот (l-лизин). 13C6, l-аргинин 13C6; CLM-2247-H-1, CLM-2265-H-1, Cambridge Isotope Laboratories).Клетки, обработанные DAC, выращенные в обычной среде, считались легкими аналогами SILAC.

Биотинилирование и выделение белков клеточной поверхности

Раковые клетки (~ 1,5 × 10 7 клеток) выращивали в 15-сантиметровой культуральной чашке и промывали ледяным PBS (21040 см, Corning) перед маркировкой. Всего 5 мг мембранопроницаемого сульфосукцинимидил-6- (биотин-амидо) гексаноатного реагента в концентрации 0,3 мг / мл (EZ-link sulfo-NHS-SS-biotin; 21331, Thermo Fisher Scientific) было нанесено на клетки при осторожном встряхивании при 4 ° C в течение 30 мин.Реакцию гасили 20 мМ глицином (G8790, Sigma-Aldrich) в PBS в течение 10 мин. Затем биотинилированные клетки собирали соскабливанием в PBS, содержащем 100 мкМ окисленного глутатиона (G4376, Sigma-Aldrich), чтобы предотвратить восстановление дисульфидного мостика в молекуле-метке. После центрифугирования при 500 × g в течение 3 минут осадок клеток подвергали стадии замораживания-оттаивания и ресуспендировали в буфере для лизиса [2% Nonidet P40 (NP40; 11332473001, Roche), 0,2% SDS (75746, Sigma- Aldrich), 100 мкМ окисленного глутатиона и 1X смесь ингибиторов протеазы Halt (87786, Thermo Fisher Scientific) в PBS)] в течение 30 мин на льду.Затем лизат подвергали ультразвуковой обработке с пятью 15-секундными импульсами и центрифугировали при 14000 × g в течение 5 минут при 4 ° C для удаления нерастворимых материалов. Концентрацию белка в супернатантах определяли с использованием набора реагентов для анализа белков Pierce 660 нм (22660, Thermo Fisher Scientific) с добавлением реагента для совместимости с ионными детергентами (22663, Thermo Fisher Scientific). Биотинилированные белковые экстракты немеченых и меченых SILAC-тяжелых раковых клеток смешивали в соотношении 1: 1 (мас. / Мас.), И смесь подвергали биотин-аффинной очистке.Суспензию Pierce NeutrAvidin-агарозы (29200, Thermo Fisher Scientific) в 200 мкл / мг общих белков кондиционировали тремя промывками в буфере A (1% NP40 и 0,1% SDS в PBS). Связывание биотинилированных белков проводили на вращающемся смесителе при 4 ° C в течение ночи. Затем шарики дважды промывали буфером A, дважды буфером B [0,1% NP40, 10,3 M NaCl (4058-01, JT Baker) в PBS] и дважды буфером C (50 мМ в PBS, pH 7,8). Белки элюировали дважды по 30 минут каждый при 58 ° C 150 мМ дитиотреитолом (DTT; D0632, Sigma-Aldrich), 1% SDS, 50 мМ Tris-HCl в PBS (pH 7.8). Затем к образцу добавляли 150 мМ йодацетамида (IAA; I6125, Sigma-Aldrich) с последующей инкубацией в течение 30 минут при комнатной температуре в темноте для алкилирования восстановленных остатков цистеина в белках. Чтобы сконцентрировать белки и уменьшить количество детергентов в элюате, обогащенном мембранами, мы очистили элюат с помощью центрифугирования Amicon MWCO-10K (UFC501096, Millipore) с обменным буфером [0,5% SDS в 50 мМ NH 4 HCO 3 (09830, Sigma-Aldrich) водный раствор].Затем образец, оставшийся в обменном буфере, извлекали для последующих анализов 70 .

Расщепление в геле и масс-спектрометрия

Очищенные белки с биотинилированной поверхностью фракционировали с использованием SDS-PAGE с последующим расщеплением трипсином в геле 71 . Трипсинизированные пептиды сушили в вакууме и солюбилизировали в 0,1% трифторуксусной кислоте (TFA; 299537, Sigma-Aldrich). Затем образец обессоливали с помощью C18 Ziptip (ZTC18S960, Millipore) в соответствии с протоколом производителя.Сбор массы пептидов выполняли на системе Ultimate system 3000 nanoLC, подключенной к масс-спектрометру Orbitrap Fusion Lumos, оборудованному источником ионов NanoSpray Flex (Thermo Fisher Scientific). После загрузки пептидов в прибор для ВЭЖХ пептиды концентрировали с помощью обращенно-фазовой ловушки C18 Acclaim PepMap NanoLC длиной 25 см и внутренним диаметром 75 мкм, содержащей частицы C18 размером 2 мкм с размером пор 100 Å ( 164941, Thermo Fisher Scientific). Водный растворитель подвижной фазы A (0.1% муравьиная кислота; 33015, Sigma-Aldrich) и органический растворитель B [0,1% муравьиной кислоты в ацетонитриле (9829, JT Baker)] смешивали для получения линейного градиента от 2% до 40% растворителя B для фракционированного элюирования пептидов. Масс-спектры были получены в результате одного полного сканирования МС с последующим зависимым от данных МС / МС наиболее интенсивных ионов в течение 3 с. Полное сканирование МС было записано с разрешением 120000 на м / z 200. Для спектров МС / МС выбранные родительские ионы в пределах окна изоляции 1,4 Да были фрагментированы высокоэнергетической диссоциацией, активируемой столкновением (HCD) с зарядовым статусом от 2+ до 7+.Продолжительность динамического исключения родительских ионов была установлена ​​на уровне 180 с с подсчетом повторов. Масс-спектры записывали с помощью инструмента Xcalibur версии 4.1 (Thermo Fisher Scientific).

Анализ данных ЖХ-МС / МС и количественный анализ белков на основе SILAC

Полученные файлы Thermo RAW анализировали с помощью MaxQuant v1.6.0.16 72 . Спектры МС / МС искали в поисковой системе пептидов Andromeda по базе данных протеома человека UniProtKB / Swiss-Prot, а также по обратному аналогу в качестве базы данных-приманок.При поиске использовался список распространенных загрязняющих веществ, предоставленный программой MaxQuant. Рассматривались пептиды с минимум шестью аминокислотами и максимум тремя пропущенными трипсином расщеплениями. Настройка переменных модификаций включает окисление метионина, N-концевое ацетилирование белка, дезамидирование аспарагина / глутамина и связь EZ на первичных аминах после восстановления сульфгидрила и алкилирования с помощью IAA (EZ-IAA, +145,020 Да) 73 . Карбамидометилцистеин применялся как фиксированная модификация.Исходный родительский пептид и толерантность к массе фрагмента были установлены равными 20 м.д. и 0,5 Да, соответственно. Фильтрация ложной скорости обнаружения (FDR) совпадения пептидного спектра и отнесения белков использовалась при 0,05 и 0,01, соответственно. Наконец, белки, идентифицированные как обратная ловушка, сопоставленные только с одним уникальным пептидом и как обычные загрязнения, были исключены перед дальнейшим анализом.

Клетки рака легких, полученные от пациентов из злокачественных плевральных выпотов

Злокачественные плевральные выпоты пациентов с раком легких центрифугировали при 1800 × g в течение 5 минут для сбора осадка клеток.Осадки клеток ресуспендировали в 4 мл PBS и подвергали центрифугированию в градиенте плотности с Ficoll-Paque PLUS (17144002, GE Healthcare) в соответствии с инструкциями производителя. Вкратце, ресуспендированные клетки осторожно загружали в 3 мл Ficoll-Paque PLUS в центрифужной пробирке на 15 мл и наслаивали центрифугированием при 1800 × g в течение 20 мин при комнатной температуре. Ядерные клетки, обогащенные на границе раздела, собирали и промывали, по крайней мере, тремя объемами PBS. Затем клетки осаждали центрифугированием при 300 × g в течение 5 мин.Эритроциты (RBC) в клеточном осадке лизировали буфером для лизиса RBC [155 мМ NH 4 Cl (11209, Sigma-Aldrich), 10 мМ KHCO 3 (2940-01, JT Baker) и 0,1 мМ EDTA. (34550, Honeywell Fluka) в деионизированной воде] и выбрасывали после центрифугирования образца при 300 × g в течение 3 мин. Осадок клеток, наконец, дважды промывали PBS и центрифугировали при 300 × g в течение 3 минут. Собранные клетки выращивали в среде DMEM / F-12 (1: 1 по объему; 11330, Thermo Fisher Scientific) с добавлением 5% FBS, 2% пенициллин-стрептомицин, 0.4 мкг / мл гидрокортизона (H088, Sigma-Aldrich), 5 мкг / мл инсулина (I2643, Sigma-Aldrich), 10 нг / мл эпидермального фактора роста (PHG0311L, Invitrogen), 24 мкг / мл аденина (A2786, Sigma-Aldrich). ) и 6 мкМ Y-27632 (ALX-270-333, Enzo Life Sciences). Плавающие лимфоциты в первичной культуре удаляли промыванием PBS перед отделением прикрепленных клеток трипсином-EDTA (25200072, Thermo Fisher Scientific) в концентрации 0,25% в PBS во время каждого пассажа. Удаление фибробластов было достигнуто благодаря их более быстрой адгезии к культуральной чашке, чем опухолевые клетки.Мы перенесли суспензию трипсинизированных клеток в новую чашку для культивирования и оставили при 37 ° C, пока два типа клеток не были отделены друг от друга. После повторных пересевов чистоту популяции опухолевых клеток подтверждали измерением поверхностной экспрессии ЕрСАМ с помощью проточного цитометрического анализа 74 .

Выделение и размножение ex vivo γδ Т-клеток

1 × 10 7 Мононуклеарные клетки периферической крови (PBMC), полученные от здоровых доноров, высевали в каждую лунку, покрытую антителом против TCR PAN γ / δ (клон IMMU510), используя 6-луночный культуральный планшет.Культуральная среда содержала Optimizer CTS T-Cell Expansion SFM (A1048501, Thermo Fisher), 15 нг / мл IL-1β (AF-200-01B), 100 нг / мл IL-4 (AF-200-04), 7 нг. / мл IL-21 (AF-200-21) и 70 нг / мл IFN-γ (AF-300-02, Peprotech). Через семь дней среду заменили на среду Optimizer CTS, 5% лизат тромбоцитов человека (PLS1, Compass Biomedical), 70 нг / мл IL-15 (AF-200-15, Peprotech) и 30 нг / мл IFN-γ. . Эти клетки собирали на 21 день для последующих экспериментов, включая исследования цитотоксичности in vitro и эксперименты на животных.Мы соблюдаем все этические нормы. Информированное согласие было получено от отдельных здоровых доноров до включения в исследование. Исследование было одобрено институциональным наблюдательным советом (IRB) Национальной университетской больницы Тайваня.

Иммунофенотипический и функциональный анализ γδ Т-клеток

Ex vivo-размноженные γδ Т-клетки дважды промывали PBS и окрашивали иммунофлуоресцентными антителами, нацеленными на поверхностные маркеры, включая γδTCR Vδ1, γδTCR Vδ2, CD27, CD69, NKG2D, TGF-β1, и CD107a (дополнительная таблица 2).Затем γδ Т-клетки фиксировали и повышали проницаемость с использованием раствора Cytofix / Cytoperm (554714, BD Biosciences) в течение 20 минут при 4 ° C для внутриклеточного окрашивания цитокинов, включая IL-2, IL-10, IL-17A, IFN-γ, и TNF (дополнительная таблица 2). Окрашивание проводили при 4 ° C в течение 30 мин в темноте. Образцы промывали и фиксировали 100 мкл фиксирующего раствора 1X IOTest3 (A07800, BECKMAN COULTER) на лунку в течение не менее 10 минут при 4 ° C. Затем клетки ресуспендировали в 300 мкл PBS и анализировали с использованием проточной цитометрии BD LSR Fortessa (BD Biosciences).Полученные данные анализировали с помощью программного обеспечения FlowJo (Tree Star). Стратегии гейтинга представлены либо на рисунке, либо на дополнительном рисунке 16. Для измерения полифункционального ответа γδ Т-клетки стимулировали 30 нг / мл форбол 12-миристат 13-ацетата (PMA; P1585, Sigma-Aldrich) и 1 мкг / мл. мл иономицина (I9657, Sigma-Aldrich) в присутствии монензина (00-4505-51, eBioscience) и брефельдина A (420601, BioLegend) в течение 4 ч при 37 ° C. После стимуляции γδ Т-клетки переносили в 96-луночные планшеты с v-образным дном и окрашивали на поверхностные маркеры и внутриклеточные цитокины, как описано выше.В качестве неактивированного контроля γδ Т-клетки инкубировали только с диметилсульфоксидом (ДМСО; D2650, Sigma-Aldrich), монензином и брефельдином А перед окрашиванием.

Массовая цитометрия единичных клеток

Образцы обрабатывали, как описано с небольшими изменениями 75 . Вкратце, образцы клеток сначала окрашивали на жизнеспособность цисплатином (201064, Fluidigm), а затем фиксировали 1,5% параформальдегидом (15710, Electron Microscopy Sciences) при комнатной температуре в течение 10 минут с последующими двумя промываниями средой для окрашивания клеток (CSM) [PBS содержащий 0.5% бычий сывороточный альбумин (BSA; A3059, Sigma-Aldrich) и 0,02% азид натрия (S2002, Sigma-Aldrich)]. Затем образцы клеток, фиксированные формальдегидом, подвергали предварительной проницаемости палладиевому штрих-кодированию 76 . Образцы со штрих-кодом сначала инкубировали с анти-TCR Vδ 1-FITC в течение 30 минут на льду, один раз промывали CSM, а затем окрашивали металл-конъюгированными антителами против поверхностных маркеров в течение 1 часа. После инкубации образцы промывали один раз CSM, повышали проницаемость с помощью 1x буфера для пермеабилизации eBioscience (00-8333-56, Thermo Fisher Scientific) на льду в течение 10 минут, а затем инкубировали с металл-конъюгированными антителами против внутриклеточных молекул в течение 1 часа.Клетки промывали один раз с помощью 1x буфера для пермеабилизации eBioscience, а затем инкубировали при комнатной температуре в течение 20 минут с иридий-содержащим интеркалятором ДНК (201192 A, Fluidigm) в PBS, содержащем 1,5% параформальдегида. После интеркаляции / фиксации образцы клеток промывали один раз CSM и дважды водой перед измерением на массовом цитометре (Fluidigm). Нормализация чувствительности детектора была выполнена 77 . После измерения и нормализации индивидуальные файлы были отключены от кода 76 и стробированы в соответствии с дополнительным рис.2b. Карты viSNE были созданы с использованием программных инструментов, доступных на https://www.cytobank.org/. Для конъюгации антител антитела в PBS без носителя конъюгировали с металл-хелатными полимерами (дополнительная таблица 3) в соответствии с протоколом производителя. Конъюгацию антител к висмуту проводили, как описано ранее 78 .

Анализ данных массовой цитометрии

Для сравнения ex vivo расширенных γδ Т-клеток с обработкой DAC и без нее, по 50000 клеток из каждой группы были случайным образом взяты образцы и объединены вместе для кластеризации с использованием X -двиг 79 , a метод кластеризации на основе плотности.Все маркеры, кроме используемых для стробирования, были выбраны для кластеризации. Кластеры, разделенные расстоянием Махаланобиса <2,0, были объединены. Оптимальный параметр ближайшего соседа K был определен как 20 с использованием метода локтя. Уровень экспрессии и частота клеток в каждом кластере были экспортированы и представлены тепловыми картами и круговыми диаграммами с использованием R. Для корреляции между уровнями экспрессии маркеров в CD3 + Т-клетках на исходном уровне и после размножения ex vivo были рассчитаны парные коэффициенты корреляции Пирсона.Тепловая карта была сгенерирована и сгруппирована на основе иерархической кластеризации коэффициентов корреляции Пирсона с помощью R.

Анализы цитотоксичности, опосредованной γδ Т-клетками

Раковые клетки были совместно культивированы с γδ Т-клетками при соотношении эффектора к мишени (E: T) 3: 1 при 37 ° C в течение 2 часов. После совместного культивирования гибель клеток оценивали с помощью проточного цитометрического анализа с использованием набора для обнаружения апоптоза FITC Annexin V Apoptosis Kit I (556547, BD Biosciences). Кроме того, мы выполнили мониторинг в реальном времени γδ T-опосредованного уничтожения раковых клеток с использованием системы мониторинга Electric Cell-Substrate Impedance Sensing (ECIS) с камерой для культивирования 8W10E + (Applied Biophysics).Раковые клетки, обработанные имитатором или DAC, культивировали в камере при 37 ° C в течение ночи до тех пор, пока раковые клетки полностью не прикрепились к дну лунок. После добавления γδ Т-клеток отделение раковых клеток, указывающее на гибель клеток, регистрировалось в режиме реального времени с использованием многочастотного захвата с помощью программного обеспечения ECIS. Относительную зависимость во время добавления γδ Т-клеток использовали для нормализации между образцами. Для бесконтактных экспериментов по уничтожению раковые клетки высевали в нижние лунки 24-луночной системы Transwell в течение ночи с последующим добавлением γδ Т-клеток в верхние 0.Вставки мембраны с порами 4 мкм, непроницаемые для клеток (353095, Falcon). Совместное культивирование проводили при соотношении Е: Т 10: 1 при 37 ° С в течение ночи. Гибель раковых клеток в нижних лунках оценивали с помощью проточного цитометрического анализа с использованием набора для обнаружения апоптоза FITC Annexin V I.

Анализ хемотаксиса Т-клеток γδ

Раковые клетки культивировали совместно с γδ Т-клетками в системе Transwell с размером пор 3 мкм. мембранная вставка (3415, Falcon), которая позволяет проходить Т-клеткам γδ. Перед сокультивированием раковые и γδ Т-клетки окрашивали витальными красителями, Calcein AM (1755, BioVision) и Hoechst 33342 (h4570, Thermo Fisher Scientific), соответственно.После сокультивирования в течение 2 ч Т-клетки γδ (положительные по Hoechst 33342), которые мигрировали в нижнюю камеру, были визуализированы под флуоресцентным микроскопом и количественно определены ImageJ.

Иммунофлуоресцентная визуализация иммунных синапсов

Раковые и γδ Т-клетки центрифугировали на покрытых поли-l-лизином покровных стеклах с помощью настольной цитофуги Cyto-Tek при 500 об / мин в течение 5 минут (Sakura Scientific) перед фиксацией льдом холодный метанол или 4% (мас. / об.) параформальдегид в PBS в течение 10 мин. Фиксированные образцы блокировали в блокирующем растворе, не содержащем детергента [1% нормальной ослиной сыворотки (ab7475, abcam) и 3% BSA в PBS], без повышения проницаемости мембраны детергентами.Затем клетки инкубировали с первичными антителами, разведенными в блокирующем растворе, в течение 1 ч во влажной камере при комнатной температуре и промывали PBS. Мечение флуоресцентных вторичных антител при разведении 1: 200 в PBS проводили в блокирующем буфере в течение 1 ч при комнатной температуре. После отмывки PBS ядра клеток окрашивали Hoechst 33342 или DAPI (62248, Thermo Fisher Scientific) в PBS. Наконец, образцы были промыты PBS и помещены на предметные стекла. Все слайды исследовали под эпифлуоресцентным микроскопом EVOS FLc (Invitrogen), а изображения анализировали с помощью программного обеспечения ImageJ.Для визуализации иммунных синаптических белков клетки визуализировали с помощью конфокального микроскопа высокого разрешения (LSM780, Zeiss) с масляным объективом × 63 и анализировали с помощью конфокального программного обеспечения ZEN (Zeiss). Антитела, использованные в исследовании, перечислены в дополнительной таблице 2.

Эксперименты с избыточной экспрессией и нокаутом гена CRISPR / Cas9

В экспериментах по сверхэкспрессии был создан доксициклин-индуцибельный вектор сверхэкспрессии ICAM1 путем клонирования полноразмерной кДНК ICAM1 в лентивирусная плазмида Tet-On pLVX-Tight-Puro (632162, Clontech).Вектор, экспрессирующий ген, и вектор-регулятор (pLVX-Tet-On Advanced) были упакованы с лентивирусными частицами псевдотипа VSV-G в 293 Т-клетках. После котрансфекции двух лентивирусных частиц в клетки рака легкого клетки затем выращивали в селекционной среде, содержащей G418 (10131035, Thermo Fisher Scientific) и пуромицин (A1113803, Thermo Fisher Scientific) в надлежащих концентрациях для удержания обеих плазмид. . В экспериментах с нокаутом редактирование локуса генома ICAM1 на клетках h2299 было достигнуто за счет коэкспрессии белка Cas9 с направляющими РНК (гРНК), нацеленными на экзон 2 ICAM1 в последовательностях 5′-TCAAAAGTCATCCTGCCCCG -3 ‘и 5’. — GTGACCAGCCCAAGTTGTTG -3 ′. ICAM1 -нулевые клеточные линии были созданы путем клонального размножения из одиночных клеток. Сверхэкспрессия и потеря белка ICAM-1 были подтверждены проточной цитометрией с использованием антитела против ICAM1 (BBA20, R&D Systems). Кроме того, отредактированные паттерны генома в локусе ICAM1 вокруг сайтов нацеливания на gRNA линий, нокаутированных по ICAM1, были подтверждены секвенированием по Сэнгеру после амплификации ПЦР (см. Дополнительную таблицу 4 для пар праймеров ПЦР). Анализ результатов секвенирования для локуса генома ICAM1 под редакцией CRISPR / Cas9 выполняется с использованием инструмента множественного выравнивания последовательностей (ClustalO) в программном обеспечении QIAGEN CLC Genomics Workbench (v20.0,2).

Подготовка РНК и анализ мРНК-seq

Общую РНК экстрагировали с помощью набора PureLink RNA Mini Kit в соответствии с инструкциями производителя (12183018A, Invitrogen). Качество РНК оценивали с помощью Bioanalyzer 2100 с набором RNA 6000 Nano LabChip (5067-1511, Agilent Technologies). Библиотеки мРНК-seq получали с использованием набора TruSeq Stranded mRNA Library Prep Kit (RS-122-2101, Illumina) и секвенировали с использованием системы HiSeq 4000. Необработанные чтения были обработаны с обрезкой адаптера и фильтрацией качества с использованием Trimmomatic с настройками по умолчанию 80 .Очищенные считывания были сопоставлены с геномом UCSC hg19 человека с использованием инструмента RSEM с выравнивателем bowtie2 81,82 . Картированные чтения были подсчитаны для каждого гена с использованием пакетов R GenomicFeatures (v1.36.4) и GenomicAlignments (v1.20.1) в соответствии с аннотацией GENCODE human GRCh47 (https://www.gencodegenes.org/human/release_25lift37.html) 83 . Наконец, FPKM-нормализация необработанных подсчетов была выполнена с использованием DESeq2 (v1.24.0) 84 . Гистограммы и точечные диаграммы данных RNA-seq были созданы с помощью ggplot2 (v3.2.1). Анализ сетей и вышестоящих регуляторов был проведен с помощью Ingenuity Pathway Analysis (IPA; версия 01-16, Qiagen).

Генетическая онтология и анализ обогащения набора генов

Поверхностные белки, повышенные более чем в 1,4 раза при обработке DAC в количественном протеомном анализе мембран, были подвергнуты анализу онтологии генов (GO) с использованием веб-инструмента AmiGO 2, PANTHER (v2.5.12 ), с точным критерием Фишера. Для анализа обогащения набора генов (GSEA) мы использовали данные последовательности мРНК линий раковых клеток с обработкой DAC и без нее, чтобы идентифицировать наборы генов, обогащенные в образцах, обработанных DAC (FDR <0.25 и номинальный p — значение <0,05). Связанные с цитоскелетом наборы генов извлекаются из базы данных молекулярных сигнатур (MSigDB, v6.2).

Анализ метилирования ДНК по всему геному

Геномную ДНК раковых клеток экстрагировали с помощью набора QIAamp DNA Mini (51304, QIAGEN) в соответствии с инструкциями производителя. Концентрацию и качество ДНК оценивали с помощью NanoDrop 2000 (Thermo) и электрофореза в 0,8% агарозном геле соответственно. Бисульфитную конверсию 1 мкг геномной ДНК проводили с использованием набора для метилирования ДНК EZ (D5001, Zymo Research).Образцы ДНК, преобразованные бисульфитом, подвергали полногеномному анализу метилирования с использованием чипов Illumina Infinium MethylationEPIC BeadChips. Необработанные данные об интенсивности были получены в виде файлов IDAT и обработаны с использованием пакета R minfi v1.30.0 85 с пакетом аннотаций датчиков для массива Illumina EPIC (IlluminaHumanMethylationEPICanno.ilm10b4.hg19). Данные были нормализованы по квантилю с использованием функции preprocessQuantile minfi. Мы удалили некачественные зонды с детектированием P -value> 0.01, а также зонды, описанные как однонуклеотидные полиморфизмы (SNP), перекрестно-реактивные и генетические варианты 86,87 . Наконец, для дальнейшего анализа было использовано 692 476 зондов.

Анализ доступности хроматина по всему геному

Доступность хроматина для клеток рака легкого до и после лечения DAC анализировали с использованием протокола Omni-ATAC 43 с модификациями. После сбора клеток с трипсином / ЭДТА всего 1 × 10 5 клеток ресуспендировали в 1 мл холодного буфера для ресуспендирования ATAC [ATAC-RSB; 10 мМ Трис-HCl pH 7.4, 10 мМ NaCl и 3 мМ MgCl 2 (AM9530G, Thermo Fisher Scientific) в воде] с добавлением 0,1% Твин-20 (P2287, Sigma-Aldrich). Клетки центрифугировали при 650 × g в течение 5 минут при 4 ° C для удаления буфера и лизировали в 50 мкл ATAC-RSB, содержащего 0,1% NP40, 0,1% Tween-20 и 0,01% дигитонина (G9441, Promega) на лед в течение 3 мин. Затем лизат промывали 1 мл ATAC-RSB, содержащего 0,1% Tween-20, и супернатант удаляли после центрифугирования при 650 × g в течение 10 мин при 4 ° C для осаждения ядер клеток.Затем ядерную фракцию ресуспендировали в 50 мкл 1: 1 (об. / Об.) Премикса 2X Tagmentation DNA (TD) буфера [20 мМ Трис-HCl, 10 мМ MgCl 2 , 10% диметилформамида (D4551, Sigma- Aldrich), pH 7,6] и буфера для транспозиции [2 мкл адаптеров Illumina, содержащих транспозазу Tn5 (FC-121-1030, Illumina), 0,02% дигитонина и 0,2% Tween-20 в PBS]. Образец инкубировали при 37 ° C в течение 30 минут на водяной бане и встряхивали каждые 5 минут для облегчения реакции транспозиции. В конце реакции транспонированные фрагменты ДНК собирали и очищали с помощью набора Zymo DNA Clean and Concentrator-5 (D4011, Zymo Research).Библиотеки были проиндексированы и амплифицированы с индексирующими праймерами Illumina i5 / i7 (FC-121-1011, Illumina) с помощью реакции ПЦР для достижения целевой концентрации 4 нМ в 20 мкл. Качество библиотеки проверяли на биоанализаторе Agilent 2100 с набором высокочувствительной ДНК (5067-4626, Agilent Technologies). Образец секвенировали на платформе Illumina HiSeq X Ten с секвенированием парных концов 151 п.н., в среднем 60 миллионов необработанных считываний на образец.

Биоинформатический анализ данных Omni-ATAC-seq

Последовательность адаптера Nextera (5’-CTGTCTCTTATACACATCT-3 ’) была вырезана из необработанных считываний с использованием CutAdapt v2.7 88 . Урезанные чтения каждого образца были сопоставлены с построением эталонного генома человека UCSC hg19 с использованием BWA mem v0.7.17-r1188 89 с параметром -M по умолчанию и максимальной длиной фрагмента 2000. Дублированные чтения ПЦР были помечены с помощью Picard (v2.21.4, http://broadinstitute.github.io/picard/). Дальнейшую качественную фильтрацию выполняли с помощью SAMtools (v1.9, PMC2723002) для удаления несформированных считываний, несопоставленных спариваний, дублированных считываний ПЦР, неспаренных выравниваний и считываний, сопоставленных с митохондриальной ДНК.Распределение размеров отфильтрованных чтений и частота занятости нуклеосом оценивались с помощью ATACseqQC v1.8.5 90 . Области широких пиков ATAC-seq были вызваны с помощью MACS2 v2.2.5 91 с параметрами: —nomodel —shift -75 —extsize 150 —keep-dup all —broad —broad-cutoff 0.1. Аннотации пиков и расстояние от каждого пика до ближайшего TSS определялись с помощью ChIPseeker v1.20.0 92 . BAM-файлы постфильтрации выравнивания чтения из образцов, обработанных имитацией и DAC, были одновременно нормализованы с использованием подхода чтения на геномное содержимое (RPGC) с помощью —effectiveGenomeSize 2827437033, а соотношение log2 DAC / mock на бин было сообщено с помощью deepTools v3. .3,1 93 .

Транскриптомные данные тканей первичного рака легкого

Данные об экспрессии генов по всему геному с помощью mRNA-seq были получены из двух когорт аденокарциномы легких, Национальной больницы Тайваньского университета (NTUH) и из базы данных Атласа генома рака (TCGA). Данные NTUH были созданы нашей лабораторией и депонированы в базе данных Gene Expression Omnibus (GEO) с регистрационным номером GSE120622. Данные о нормализованной экспрессии генов (RNASeq2GeneNorm) и клиническая информация из курируемого TCGA аденокарциномы легкого (LUAD) и клинической информации были получены с использованием пакета R, curatedTCGAData v1.6.0 94 . Тепловые карты уровня экспрессии Z-трансформированного гена выбранных генов NTUH и TCGA-данных мРНК-seq были созданы с использованием пакета pheatmap пакета R (v1.0.12).

Комбинированная терапия DAC и γδ Т-клеток в модели мышей с ксенотрансплантатом

Шестинедельные самцы мышей NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) были приобретены в Национальном центре лабораторных животных (Тайвань) и содержались в соответствии со стандартом. состояние, свободное от патогенов. Всех мышей содержали в аккредитованном AAALAC учреждении для животных с 12-часовым циклом темнота / свет (8 a.м. до 20:00) при температуре от 20 до 24 ° C и влажности от 50 до 70%. Клетки рака легких h2299 вводили мышам подкожно (1 × 10 7 / мышь). Терапия была начата через семь дней после инъекции. Для каждого двухнедельного цикла лечения мышей с опухолями обрабатывали DAC (0,2 мг / кг массы тела) путем внутрибрюшинной инъекции в дни 1, 2 и 3. Человеческие γδ Т-клетки (1 × 10 7 / мышь) были внутривенно вводили через хвостовую вену на 5-й и 10-й дни. За мышами наблюдали один раз в неделю и измеряли размеры опухоли цифровым штангенциркулем.Эксперименты прекращали, когда размер опухоли достигал 20 мм или наблюдалась потеря веса на 20% или более в соответствии с этическим советом учреждения. Регистрировали время выживания отдельных мышей в каждой экспериментальной группе. Выживших мышей на 42 день после инъекции опухоли умерщвляли для получения опухолей для патологического исследования и окрашивания гематоксилином и эозином (H&E). Для визуализации транспорта γδ Т-клеток in vivo, γδ Т-клетки (1 × 10 6 клеток) предварительно окрашивали долговременным индикатором клеток CYTO-ID Red (Enzo Life Sciences, Фармингдейл, Нью-Йорк).Клетки рака легких h2299 вводили мышам NSG подкожно. Через неделю мышей с опухолью обрабатывали DAC (0,2 мг / кг массы тела) путем внутрибрюшинной инъекции в течение 3 дней подряд (дни 1-3) с последующей инъекцией в хвостовую вену предварительно окрашенных γδ Т-клеток (1 × 10 7). / мышь) на 5-й и 12-й день. Изображения были получены через 2 и 4 часа после инъекции γδ T с использованием IVIS Spectrum (Ex570, Em640) на 12-й день. Все эксперименты на мышах были одобрены Медицинским колледжем NTU. Комитет по уходу и использованию (IACUC; протокол № 20180077) и мы соблюдаем все этические нормы при испытаниях и исследованиях на животных.

Статистический анализ

Статистический анализ проводился с использованием GraphPad Prism 8 и вычислительной среды R. Двусторонние тесты Манна – Уитни или непарные t -тесты использовались для сравнения средних значений между двумя группами, тогда как односторонний дисперсионный анализ ANOVA с множеством Тьюки Сравнения использовались для сравнения средних значений трех или более групп.

Добавить комментарий

Ваш адрес email не будет опубликован.